Description :
repeat
Sequence
25 bases(100 bases per row)
GTTTTCCGTTTTTTTCCACGTTTTT