Description :
repeat
Sequence
40 bases(100 bases per row)
CCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATC