Description :
repeat
Sequence
31 bases(100 bases per row)
TACGCCGAGTACGCTGAGTACGCCGGGTACG