Description :
promoter
Sequence
42 bases(100 bases per row)
AGAGTCTGACGTGGTTTACCAATTTGCATCGAGCTTTATATA