Description :
repeat
Sequence
144 bases(100 bases per row)
GGAGATTGAGGAGGTTGAGGAGGTTGAGGAGGTTGAGGAGGTTGAGGAGGTTGAGGAGGTTGAGGAGGTTGAGGAGTCTGAGGGGGTTGAGGAGGTTGAG
GAGGTTGAGGAGTCTGAGGAGCCTGAGGGGGTTGAAACAGAGGT