Description :
repeat
Sequence
97 bases(100 bases per row)
TCGCCTTAAAGGTAAAGTATAAGTGACCCACTTTAGCGTCATCCATTTTCATGGCTAGTTCATTCGGCAGGTGAGTTGTTACACACTCCTCAGCGGA