Description :
Non Conding Region
Location :
Scaffold_1:99743- 101744
Sequence
2001 bases(100 bases per row)
GTTGTCTGGTGTTGCTGGCGATTGCGACCAAGATCAATGGCATGGGTCATCGAAGGTTCCATTGATTTGCCACGAGCCATAAAAACCCAGGGTTTGCGAA
AGGTGGGTTTTAATTTCAGCCACAGGTTGGTTACACCAGTCACGGTTGGTGACGAACTTGTGGCTGTAGGCAACAGCCGTTGGAGTCACCGACTGGAAAC
TGGATTTTGACCAATCAAACGGCGATATGGACATTATCATTGTGGCTATGGAGGAAGCTGTCAACAATCGTACTCGTTAGGGCCAAATAGAGAGCTGCAG
CATAGATTTTGCCCATTGCGATTCGATTCCCGGTCGATATTTGGCATCCGAGTCCCAGTCTACTAAACCTTGCTTGCTTTGCCCTCCACCGAGCAAACGG
AAGGCTCTGTCTGCTTTGACTTCAGCTACAGTTTGTTTTTCATGTGGCTTGGCCTTCGCACAGCTACGAAACACTAGATGTCCGATGGAAGTTCCACCAC
GCACGCGGTAATGTACTCGGCCAATGACCACTGGCTCATATCTTGTGTGGTTCTTTGGTTTGGAGTTGCTGGCGCATTTGTATGTATCGTCCAAGTGGAA
GTGGCTTGTGATTGTTGTTTTGCTGAGAACTCACAACCCGTCAACTTCACTCGTTTTTACATCTTATGGACTGAGACGAGGTCACGCTTTTCATTGTTAC
TGTATCAGCTGTCCATCCTCGGCTGATACACCAAGTGCACTTGACTGCGATTCTCGCAGGAGACGTACCGGTATTGGCGGAGGCACGAAATGATAGACAC
CACCTTGGAGTGATAATTTCCCAACAGCAGAGGAGAAAGAATAAGATGGTTACTACTGGATGGAATACAATTGAAGGTCAACCAATGTCCCGAGCCAGCT
TCCTGTGGTGTCCACATTCGAAGTTTGGCAACGTCTGACTTTGTGAACACTTGGCCTGGATCTTTTTGTATGGACAAGCGGTAGGCGACACCCGAGACAC
ACAATCGCAAATTGGTGCACTTTCACGTCAGCGCTTGATTCACTTACGTCGTATTGCAAACGTTGACCATGGAAACCAAACAATCACACTTTTGTGCGGA
TTTGCACTTGGGATCAGTTTTGTCCATTTATTTTGCATAGAGCGCGCACATTCCTGTCGGATTGTGCTATCTGCACTATGGTCCCTCGCCTCTATGGACA
GAGCCAGAGTTTGCGATTGGTGCCGTTGACCTCGCTCGCTTGTCAAGCGATCACACGACAATTCGACCACTGTCGCTTCGTGCTACGTGCTGCCGTTCGC
GAGGGCGAGTGATTCTATTGGAATTGGCGGCAATTTTGGCGGAACATTGAACATTGTGGTACAGATCGGCTTGGAATGATGTCCAAGAGCTGCCAGTCGC
CAGGCTTTAGAAAGCTGTACACATGGCCAGTACAGTTGTGTCCTTCGCCATTTGCACTCACTCGCAGCAGCCAAACGACACTGAAATGCACTTGTCCGCC
TCGACTCTACGCGACTCGCAAAGCCTCACTTCCATTATTCCAGCTGGCAGGCGGAAGAGCCAGTGCCTCGGTATTCAGCACCACAACCCACCTCCTTATG
TCCTCAATACCTTTTAATCATACTGTATCCAATGTATATTCTATATTCAAAATGATACTTTACTGTAGACATTTCATGTTATAAACCTCTATATAGTAGA
TAACCATGCCTGAGATCGCCGCTGATGTGAGTTTTTTCGACATTTTCGATCCGGTTTCATTCGTTCGTCGTGCATTGTGTGCCTGGCGAACGGTGGAAAG
CGCCGCGGAACCATCTGACACAAGCAGCTCCAGTCAGCCGCCATTGCCATTCCCCCATTGACGTCGAGACGGCCAGTACTGAATTCCTGCTCTCCCCCTC
TCTGTAAAGGCTCCGGCGGCGATCTCCCAATCTCCCACTCGCAGGCAGCAGCGCATTCCATTCTATTCAGACACAGATCAGCGCAATTCCATCAAGCAAC
A