Description :
Non Conding Region
Location :
Scaffold_1:99734- 99892
Sequence
158 bases(100 bases per row)
TTGATTGACTTGTAAGCTTTCTAGCCTGTCTCTCAATCGATGCACTTGAATTGATTGACTCGAGTAGCATCCTTATTGCAAGGATAATGTCCCGGAGATA
TCATCATCGCCACGAATCAGACCAAGTTAGAATTCGAGCAACATTATTTGGAGAGATT