Description :
Non Conding Region
Location :
Scaffold_1:99641- 100218
Sequence
577 bases(100 bases per row)
GTAACTTAGCACGATGCTACGTTGCAATTAGCAGGCCCCTCACGAGGTTCGACGAGAGAGCGCCGACATCCCGATGAAGCCACGCGGCCTCGACTACAAA
TACAAGCACAAATCTCAGCGCCGCGAGGCAACCCACGCTGCCGCCCACTGCTCCCACAACTGCTTTTTTCACAGTCCCCGATGCTCGGCTCATGATGCAA
CGCGCCACGAAAACGCTGACACACGACTTTACCCGCAAGTGTCGTCGAACCGTAAGTAACTATCGGATCAAACAGGTTTCTGGAATCTGTTTATACCGAT
ATGTACCTACACAAATCAGTTAAGTACCTATATACAAGTATTACTTATTAAGTATGTTGTGTACAATGCTCACTCCACAACCTTCAACTCTCGATGTTTT
CATATGTGTTATCGCAGGTGTGCAGCACCGCTTAAAGCTTTGCATACGAAAACTGGCTGGATTGCTGCTGGTCGGGCGGACGTCGGCACTCTCACTCTTG
CACCTCCGACGCCGTAGCTCTCGGCCTCGGCTCACCTCCAGCGCCAGACCCCGCTCCTCGCATCTAGCCAGCCAGCA