Description :
Non Conding Region
Location :
Scaffold_1:9953- 10636
Sequence
683 bases(100 bases per row)
TACGGCGCACCAATAGACGTTCAATAACCACTGCGATTAGCTCGGTCTGTTGTCGGCGCCACACCCATCAGTCCCGATTCAGTACCAAAAAaaCAGAACA
ACATGGCCAACTCACCACTGCCATTGAACGATCCAAGGACCAAGAaGAgCGCGGgTATGCAGGCTGCGCTTTGTAaTACTGTGCCACGATCGTGTGGTGC
AACAGCGCCTTCAAATCACGGTCTGCAATGCTGGCAAGCCGCCGTCCAAGTTCATTCCGTACCAGATCGTCCACAGGTCTCAACTCTGCAGCCCTGTGTT
TCAGTTGGCGTTAGCAAGCTTCCTCGACATCCTCCCTAATGTCCACGACGCACCTGAGGACGTAGACACGTAGCGACATGCGAGCATCACCAAGCGCCTC
CATCGTGTCTTGAAGCTTGGGGgCGGgAAACTCGAACGGGACTAAGTGCGCATTCCTTAAGTTCGCCTCTGTCAAGCGGAATGATGGTCCGGTTACACTT
GTGGTGTGAAGTGAGGGTACAGTACACGACACAGTTGTTCGCTGACTTTTTTGAACGATACAGCACAATATCCGCCAATCATGTTTCCTTTCAATTACAT
TTCAACCAATGATATCAAAAGGTGCCGCCAATAGCCTGCGTCaTAAGTGCATCCATGGCATTCGTCGAGTTCCTCGCTGGTCA