Description :
Non Conding Region
Location :
Scaffold_1:99527- 105733
Sequence
6206 bases(100 bases per row)
ATTCCGTTCGTTGGTGCAGTTCCGTACTGCTCGCAACCAAAAGCGCCTGCCAGGGCCAACCAATCGTGCACGCGTCGACGCTGATTGGTCCTTTTCCTTT
TACTGCTCGGTTTAACTCGACGCGGTTCACTGAACCGCTAGTACGGGAAGGGCTCCAGGATGGGTGTTCTCCCGCTTTATAACTAATGTGTCACACACCA
TGATGTCAACTTACACGAAGCTGAGAATGAGTAAATAGCCGACGAGCGTAATTTGTAGTAAAGGTGGTTTAACCTATAAAAGTAGAACAGTGATTGCTGG
CTGTCGATGCCGCATCACGGGTTTGTTTTGTCTGATGTAGGACGGGCATTTCAGCATAACTAGATTCTAGAATACAGCTTGTCGGTCGGATTAATAACGG
GAGTAATTAGACTTAAGGATAGCGTCTTCGCGCCGAAATCGCTCGTTGTTGATCAAGGTTTCTCTCAAGTCACGATGATCAGATAGCCCCACGATTGTAG
AGGTTCCCAGCGTAGCAAATATACACTAGTAGACGTCCCTAAAGCGTCAGAGAGCCCAATTCTTGTAGTGCTGGTTTGCGACGCTACGAGCATGTATTTA
ATGAAGACATACAGAGGCTTCTTGGTGCGATCATAAAGCCAGCCTCCACGTTCCATGTTATGCATGTATTGACACGTAGGACCTACACTTAGATCTGTAG
TGTGTTGTGCAATGTATGCTAGTTGAGTCACGTATGTTAGTATGCTGGTTGAAAACAGCAATGATGCTCCTAAGCTACTATCGTAGTAAAGGTACTTTCA
ATGTTTTGTGTGCGTAGCCTCACTGAAAGTCAAAAGGATAATGAGGAAGGCTATCAATTAATTCCTGATTTGCGGCCGACCGTACAAGCGACTCTTCGAT
CGATTTGGGCACCTGGGAAGTGTGCCGACCAATTTACGAGCCGCTTGGACCGCGACTCTCCACACCTTTCGAACCTTTCGTCACGGGTACGAATCTTATG
AGGGACGCGACAGATTACAGTCCGGCCAAGGAGAGGACAGAACGCCGCCACGTGGAAGCCCATGTCTTTTGACCTGCTATCCAGACCATTTACCTATAGC
GTCTTTGTTGCATTCGGAGTCGTCTGCCACACCGGCAACTACTTCATCTTCTCGATAGCCTCCAACTGCTCAGTCTTTGCCGTCGGTATGGTCGACGAAT
GGTGTCATCCAGCTAAAGTCCAACTTGTCTCACCTACAAGCACCGACGAGGCGAAAAAACGAGAGAAATCTATCAGGCGACGAGGATACATACAGCGAGG
AGTATCATTGTGCGCGTGAATCGTGTAACCTTAGCCTTGACGGCTACTGAAGAATGCTCACTCCGCTTAAAGCCAGAATGCTACAATTATGGATGAACCA
GAGTATCCATTTGACGGAGCCTTCCCGGTTTGTAACAATGACGCATACCGGCGCGGATCAGCACGATTTGTGGAACTTCCAGCGCAACAAGCTTGTATAT
CGACTGTACGCCATTATGCCCACCGGATTCGTGCTACCAGAAAGAAAAACCCGGCTTCATTTCTGTCGGGAACTACTCGCTTCCAACATCGTCAAAGATT
CCGCGACTCGGGTCAAGGATCTTGCTTGCAGCGCTCAGCGGATAGTCTGCTCTTCACGCTCCCCAATTGCTGAGTTCGTATTCACACTTCTATAGATGCG
TGACCGCTGGGCGAACAAATCCTTCCGGATTGGATGTGATCATATGAAGCTAAAGCGGCCGACTTACTCGATCAGAAGGATGCGTCGAACGACTACGTAA
TTGACCGCTCTGATTTAGACGCGAATACTGCGCGACAGTGGGTCATCACGGAAGAAGATGCTATCATTCTCAAGCTAACACTGCGCGATCCTCCTATAAT
GGACTCTGGACCTCACCTATGGTTCATTACATTTGACACCATTGAATGTCCCCGGTACTTGCGAAACGGCAGTTGATAGACGGTCAACTACCGGACATCA
CTAGTCTTTCTTCACCAACCGCTAGCGTCAGGCCGACTGCCTTGCACAGCGTGCCTTAGCACAAAGCATTATCGCAAATAGTGCACACTGAGGAAAGCCC
CTGCTACAGCCAAAACGTTTACCCGCGAGGTCGTCATAATGACTTCGGTCCAAACACCAGTTCTGCAGGTCACACCATCGTTTCCGCAGTCCCAAATATA
ACTGAAGGACACCCACAGGCACCTTGCACCCGACCTGGCAGCCAAGTATCTTACCCTACTTGATGTGACTAAACATAAAGCGACACACGCTAAAGCAAAT
AAAGTTTTGCAGAAGAAGTTGCTGCTGCTGTTGCAAAGATTTGCATCGCGTTCGGTCAGCAGAAACAAGTGGCGGCTATGAAAGCAAAGCAAACTAAACT
ATATGCTCGTCAGGTGATTCTGGACCGTATCAATGCCAAGATCAAAGAGGCTAGGAAGGCTGCCAAGTATCGATCCGAGGCGAAGGGTGGTATCTCTGAG
CACAGTGCATCGTAGACAATTTTGACTATAGCGTTTGTACAGGAGAATATGGACATCGATAAGGTGGCCACAGCTGTCATCCCTACTGATTAAAAGGTCC
CATCGGCGCCTGCTACGAGCGATCCGGATGTGGAGCCAGCTTACTTCTCTCTGACTAACTACTGTGGCGGTCAATGCATATTTCTGCAGGCTGTCCGCGC
CTGACGTGTCAATGGGGCCAGCACTTGACGAGAATCTTCACGTTTCCGATTTAGTGGACAACGTGATCACTCCCCCTCTGGATTATTGTCACTTCCTTTA
CCTGAAGCGGTGTGCAAAGCCTACCGAGTCAAATCGGCCAGCAAGGTTGATAACGCAGGCGTCCCGACGTCCACGGAGATAATTGTTGTACTTTAGTCCG
TCTCTCACAGCAAAGGCTCCACCGTAGACCACATGGACCCGCCTGCACTAATACACAGGCTGATTGTACCAGGATCCACGAAACGGTACAGACAGCATTG
TTATCAAGGTCCGAACACTCAACGGTATGACATTCACTATCTGGATGATCATTCTAAGACCCCCCGCACATTGTGAGCTCGAAAAATACCCGCTGGTTCT
CCTCCGACCGTGAACGCTGCAGCGTACACGTTTACAAACTGGAAACAGGATGTCGGCATCACTTCCAACCCGGCCTTACAGAATGTACTTCGTCTTTACG
ACGCAATCCGAATTGTGGTGTCTGGTATCACTGAGCACGCCATTCCGGAAGGATCGGTGCATGATCAGGACAGTTCAACGAGTGCGAACGCAAAGCGTGC
GTCGCCGATGTAAATTCTAACGCAGCATGCTCCAGACCTGCGCTACATCACCGCTTTTGTCTCGATCTCCTCGGTTTACCGGGACCCCAACAGGTACTCG
TTAGTACAAAGGGTTCAAGGAAGAGACGAAGGGGTACATGGTGTTTATTCAAGAGGAGAACAAGGTCACGATAACCCAGCATGTGCGAAACATCGAACTG
TCAGCGCAGAACAAATCAGTCATCTTCAAAGAGCACTCGATTAAGAACACCAGGCGATTACAGCAGACATCAGGCCCAGCAGTGACTGCGCCTAGCGCAG
TGCCTATGAAAAACGTTACTTCAACACTCGGCATCAGGGAGATGCTTTGATAAATAGGGAAGCCATTTGCTCTTCCGATGGAACCCCATGTATACAACAG
CAGCGCTTAAGCAGTTGACAGACGAGGCTTTCTCGCTTAAGGCGAAGCTCATCGACGTGCGCCTGAAATTCGTCTGCGACTACGCCTGGCATGTTATAGT
TGCGGCGCCGGACGTGCGTTCCGAGTTGCAACTTCGCGGAACCTCTTGATGAAGGCACTTGACGATGCGGGGCCCGTTGAGTTGTGTGATTTGCTTCGTC
TTGGGTAAAGTTAGTGAGGTACGGAAAGCATGGCTGAGGAGGAGTGTTGGAAAAGGATGTCGCCAAAAGTGCAATTGCGCTTGAATGACGTCGATAAACG
ATGAGAATGACGACTGCTGACTTAGTGATTATATTGGTGATACTTTTTTTTTGCGACTCGATATGCGCCACTTTCGAATCGAGTGGATAGGAACGATATG
GAGTGAGAAGCAGGTTAGTGTATAAAGAAACAGAATGATAGGGGTTTTCTTTTACCACAGTGCTTTGGACTGCTTCCCTAACGCTATCGATATGGAACAG
ATTGCATAGTGTCCGACACTTCAGACATTTGACGACCTCTCGCGTTAAGAGCATTTACGCCGCTTTTAACAACAGATCTCGTTTCTTGCTTCTAATTTCC
TTAGGAGGGTAATACACGGTACGGGCGATTTCTATATAACCATCGTGAAGGAGAATGCGGCTCATAAATACAAATATCCCCCCCCAAACGATTTGCTAAA
TTGTAGGGACCAACTTGATACAAGCAATAATCTTTATCAACTAAGCAGACGATGAAGACCGTATACTGAGTGAAAACGTGCAGCTAGCGTTACTGGTAGA
CGGTAAAATTGTCATGAACACTACGTACGTGCAGTCGTAGGAGTAATCAGTATAACTTACAGTATACTTCATTAAGATAGGGGAGCAAGTTCTGGATCTC
GCCCTTTGATATAAGTAATCCAGTCCGGAGAACTGAATCAATATGCATAACACTATACAACAGCAATCACTGAAGAAGGAGTATGATGCTGTTAATGTCT
AATTGAACCCAGAAGAGTACTCATTCAATGGGATCAGCCTTTGCTAATGAGAGTCCAGCATTTACTTATGTGATCATATTTACCTTTAATCGATTTTAAG
CCAATCCCGTGCGTGCGTCACAATAGTGGCCTAGCCAAAGAGTAACTTCGTATGTGCCTATATACCTATGAGAAGGGGACAGACTTGATCGCACTTAGTA
CGTGTAAAGTACACCTAATCACGTTATTTACAGACACACACACAGATATGTACGATTTAAAAAGTTCGGCATTCAAACCTTGCGCACAATCACTAATGCG
CACAATCACTAATAGCTTCAACCTTCGGGCTCGCAATTATGTAAAGAGTGACAGTGTTTGGTTTTCCACAACACTATTGCATTCCTCAGTGCACTAACCT
TAGTCGTGCTTAATTGAGTCTATTTACTTAGCGGCTTGATATTTCGTAAAGCTCCCACTGAAGTGTAACGTGACGTAGATTCATATCGGACTGCAAGAAC
AAAGCTCGTTGTGCCCACGATGTTAGATAAAACTCAAAAATGACCCAAGTCAAACAATGAAATGTGTCGTCAGCTAAAGGACCGTTCATTTCACAGTAAC
AAGTCATGTTTCTGACGGACCAACTTCACTGAGGTCAAAAATATCCCGAACGAAGCCGCCATTGACGACCAATTTCACGTTGCTCGCACATATTATATTC
CAATAAGCACACCGTGATCTCGTATCAACAGNNNNNNNNNNACTCGAGATCTTCGACGGGGGGGGGAGCGAGGGTACCTTTACAACGAGGCGACGCAGAT
TGAGTCAGTTCGCAGATAGGTCATGATACAAATACACATAACAAAGAGATAAGAACGGAGGCGTTTTTAGTTGCTCTTTGATGAGCTATGTCCCTGTAGG
GTTCTCTCAGGGGGCACGTCGGTGTTCGTGGAGCTCGTCGATTAGACTCCATGGGGCGTATTCGATGGGGTAGCGTGGTATCAGGGTCAATGTCTTAAGT
GAGGCTTGTTATAGTTATAAGTCATTAAATAAAATCAGTTCCGCTCTTGAACAGTTTCAGACTCGTGTCGGATAAGGCGTCTATGTTCGTCAGAGTTAAG
TTCCTTACTTAAGTCTTGTAATCTTTTCCAACGACAACTGCTGAGCGTGATATTCAAGGTGCAAGCGAGTAGTTACCAGGATGTGGTTGAAAATCACAAA
TAACACAATAAGCCACAACCGTGATGCCTCATTACAAGCAAACAGCAGAGCTGACCGTCCTTTAATATTGTAAAGTGTCGATAAAGTGTGCATCGAAGAA
CAAGCGCTCAGTTGTGTCCTGCAAGTATGCTTCTGAGGATAATCAAATGTAACAAAAGCTTTCTGATAACCATGGCTTCGTACCAAAATATGTAGCGAGA
TCACCGATTCCCGCAGTAATTCGACAATTATTCCCATCTAACCACAAAATCACGCAACTTTAAAGTCAAAAACTCTTTTTTTGGATGGTCAAGACTCTCG
TCGACA