Description :
Non Conding Region
Location :
Scaffold_1:99499- 99671
Sequence
172 bases(100 bases per row)
CGATGGACGAGAGCATTGACGAAGAGATGAACGGTGCGAGTGAAGCAAAATTTGTGGTACAAAACGGGTTTTCAGTGCTGGGAATCTCTATCGCCACTGG
TTTCGATGGCTCGTTGCTAAACTTGTTGGCATTTCCTCCCTCGCGTCCGCTGCAATACACAGCAAATCCAGT