Description :
Non Conding Region
Location :
Scaffold_1:99316- 99699
Sequence
383 bases(100 bases per row)
ATGGTTTGCAAGTCCTTATCGTCGAGACGGCGCTAATTGAATACTGAACCGACGTGGCGCGCGATCCAGGATCGCCATTGCGGCAGTGTACAGTGTATGC
GTCATAAAATAAACCTGCATGCCCACATATACAAAAGGCAAGATAAAATAAAACGTCGATTAAATACTGGATGTTACTCATACCTTTTCAGCACGAAATG
CTGGCGACCTTGGTGCAACAGCAATCGCATTTCGTGAGTAGCACCCCACGACCTTGCCACGCCTTGCCTCATACCATTGCTCTTGCCATTGCACGCTTCG
TATCGCAGCTTCCATGCGCCACCACCGTATAGGGCTCGCTCCAGAATAAGGTTTGTGATGCTGCATTCGCGACGAACGGATGT