Description :
Non Conding Region
Location :
Scaffold_1:99285- 104059
Sequence
4774 bases(100 bases per row)
GTGGGCACGTCAACGCAAATTAGCAACTCACTATCTTTAGGTGGGAGCGAATAACCACCTTATATACCTTCCGGAGCGCCACGATAGATTTATCATTCGA
GTTAGCGCTGGAACAGTAGACCATTTTGAACGGCATGTCTTAGATTATTGGTGCTACCTCGAGATAGTTAGCAATATCAATTTGTACCGCTAGGGAAGTT
CATCACGCTCTCAGATGGTCATTCTGACCTACCAGAACTTCCACGTCGACCTGGAACGTCTCACTTCTCGTCGCTTACTCCTCGTTCTTACAGCAGGTCT
GCTAGGAATACTCGGTTCGCCAAACATCGTCCAGCGAAACGGATCGTTTTCTTCCGTCCACAGCAGATCGTAGGCGTCTGAGTCATTCGAAGTGAGGACT
TTCAACACCGACGTTAAATTTCGAAATCCATTGACTGCTCTGTAAACTTGTGTCGATGCATTCTCTAAAACGGCCCGCAAAGGCGCCAATGAGTCTGGTT
CTGGTGCTGGGAAGGATGtatcttgagcttgaggaaCGGCGTCGAAATTTTTAGCGTCTTTATCACTACCGgtatcatcttcgtcgtcgctatcCACGGC
CAGCCCAGCCGCAATAACCCGTTTCAGGGTCATCAAAACTGCGTCGCGCCCATTTGCACGTTCTCGTAATCGTGACACCTTTCGTGCTTGCAACGCGGTT
CGTGATACATTTTGCTCGCTTTTATCTGAAGTAGCTGATGCTACTGTTATGCCTTCTTCCTCAGACGAGTCACCAGACGATCCACTTCCACTCCCCTCTA
AAGACCCGGGATATATCACGGTAGAACTCCTCACTACTGCAGGATCATTGTTGCACGTATCAAACCGACCAGGGTCCACCGTCGCACTTATCCCCTCACC
GTTGTCATTTAAGCGACGCATCTTCGTCGGAGGTCTCACTTCATCTACTCTCTCTGCATCATCATTGTCAGACTCCACCCAACGTCGTTTTCGTTGCTTT
TCCTCTGGGGAGATAGACTTGGTCTCTGTGTTATCCACCCGTCTAGGTGGTGTAGTCTCCGTTGCTATTGGAGTTCTCTGCACCTTCCAGACACTTTCAA
CAGGGTCTTGTTGCCCGTCACTCTGCACAACCCTCCATCTGATACTTGTACGTGTCTGCGTTATTTGAACTAGTTGGAACACACAAACTGTAAGTCCGTC
ACAGGCTGGTGCATTCCTGAAGCAATAGAgtttcttcacagcagcttccgGACCAAGTTGCAGGCCGATACGCAGCAATCTCTGCCCTTCATTTTCTGAC
AAAAGTTGTAACTCTTCGACGAATTCAGTAGCAGATGCAGGCCATACAGCTACTAAATCTTCACTCCCAGCAGTAGAAAGCGCATCTACAACCTCCTGGA
AGAGCATCGTCATCTCCTCCATAACCATCACTAAAAGCGCCAACGTTCTCGTTCTTTTCGTTCTATTTaaagcagcttcaactcgacCTTAAAATAAAAA
TACAGTtttctgattggctgaaaccTAATCTAGAACTGAATCTACAACGTGAAGGTGTGTTTTAACAGCAAATACAACATGCAAATGAGATTTAAATTGT
CATATTGCAATGTTTAGTGCCGCTGAACCATTGACGACAGCGTTGAATCCTATCGATGATTTAAAAATGATCCTCGATGACACGCAGCGGTCACCTAACG
TTAATGTACGCACTCTCGAAGTCGGATGCAGTGGTGTCTCAACTATGAAGCCGAATCACTTGTGGTCAGCTTGATGACACGCCCACCGTATCGGCGTCGA
CCGGTGAGTGAAGCATCGTACCAATCGCTGCACCATGGACAGATTCCACTTTGATGCACATGGTCCGTGTGAAGGCGCTATTTATTTAATGTACGCCACC
TTCGTTCTCTGGGGTCAAGTCGTACAAAATGCTCCCAGTATTGAAAGTGACCTCTGACTTTCACTTCGAACACTGAAGTCATCTTTCTGCACGTGAGATG
ATCGCTGCTGATGGAATCGTGAACGAGTCGAAAGATTTAGGCGTGCACAACAACGTACTGGCACGTCGAATTGAGAGGAACGCTCAACTCAAGAACATGG
ACAAGCTTTACCTGCTATCCATCGTATCGTCACTGAAGATAGCGATCCGATCCGTCAGCAATGAGGTGGCTCTAGTAAATCTGCGCTTGTTGCTTGCTCG
ACTTCGAGCATCCTGGAAGTGGTAAGGTGCATCAGCTAAATCCTGCCCATTGTGTGCAGTTGGAGGGGCATTGACCGCCTTGTACTTGTTGAAGAAATTC
AAGCGCACGAACGTAGCGACGGTGTCGGTCATGGACATATGCACAAATGGATCAACCATAGGTATGCTCTCAAATCCAACCACTCTTTGAAGGCTACGAC
CCTCACCAATGGGGGTGGTGTGAAGATTTTTCGATTTTGTAACCGGGCACGAAAACATGGTCAACTAGCTAGCCCCAAATCCAGACCATTAAGGGTTTGA
CAGAAGCATTCATAAATATAAGCGACTCGGAGTCGCTGAAGAAAGGGACATTTATTTGGAAGCTAACCACTTCGCTGACACCTACTTGGACAACGATGCA
GAAGAGCTCTACCGAAGCCATTTTGCTTGCATTGTCCACAGCTACGAACGCGATGGTGTTAAATCTTGTTCGATTgcgatgaactgcagcatctgccCGA
AGTATTATCGGAACGAGAGGGCCTCTTGGATttttgctgcacttgctgcgtgAGCAAAGCGCTGGTGCAAACAAGACAGTCAGTGGCAATCAACCTGAAG
TTGGAAGATTATTTATCGGGTCAATTACGGTCTGGATCAGGCCTCATggttttttgtttttttccCGCAGCAACATTTGTGAACACTAGCAGAACGAAAC
AGTCTTAAGAACATGAAGCCGAGAGCATGTATTAGTAGTGTTTATAAAACAAGTATGAATattttcctcttctttcTACGTCTTCGTGTAGCACAATGTG
TTTCATCCAAGCAAATAAGAAATATCGACACGATCGTGGTGCATTCCCTGGCGATCATTGCTGGCCAAACCGCTGAAGGGTGAATTGTATATATAGGATA
CTCATTTTCGTGTACCTGGTGAAAACACTGGTGCACTTTGCATGGTATTCTTTATCTAATAAATACCTTGCCGGTGAGGCACTTCACAGTTCTCCGGGTC
AAACTTTCGAGCAGAGAAAATTATGCAAATTTGCTAGAGTTTCAGCTGTACCGGAAGTCGCGCTTTGACCGTCGTGCAGGGAGCGGGACAGTGGTTGCTT
TCTGTTGTTACAATTCAGTTTGTGTATGCATTGGAGGGCCTGCTCATTTCGCGAATTTAACGTTGGCATGGCTAATGAAGCAGAGCAATCGATCGAGTGA
ATGGTGACACAACAAAATAGCGGACTAACAGCTACGGCAAACAAATGTACAAACGGTGTACATTTGACCTTTTGACTTCAAGTTCGGCCAAGATACAATT
TGTCTTAGTCTCAGTTGGAAGACACGTATGAAACTGTCGCTAAGTCATAAGTCCTTGATGCCTCCGGAATGACCACCGTATTTCTACAGCAATTTGAAGG
CTCCGATTTTGCTGGCATCCGCTCCAGTTTTGTGGAAATCCACACTCATCGGGCAGTAGTCCATGGCTCCGTAGTTTTGCAATGCGCACTGTTCGTCTTT
GTAGAAAATCATCTGCGCATTGTCCGGGAAACTTATCCATTCGACGAAGAATAACCTGTTTCAGGATTGACAAAAATTCGTCGCACGCAGTTGCACACTC
TCTGAATGCCTACGGAGGTAGACAGGCGTGATACCTTTCGACGTGCTTTCAACGGTTTTCGTGGTAGATCATGCTCGCTATCATCAGAAGCAGTCGACAG
CATGTCTTTTCTCTCAAACGGTTTGCCAGAAGATTCACCCCCCACTGCCCTCAATGGGCCTTGGGGCTATCGTACTAAAACTCCTCATTGATGCAGTACC
CAAGCTGCTCTTATCAAACCGACCAGGGTCCACCGCCGCACTTATCCCCTCACCGTTGTCATTTAAGCGACGCATCTTCGTCGGAGGTCTCACTTCATCT
ACTCTCTCTGCATCATCATTGTCAGACTCCACCCAACGTCGTTTTCGTTGCTTTTCCTCTGGGGAGATAGACTTGGTCTCTGTGTTATCCACCCGTCTAG
GTGGTGTAGTCTCCGTTGCTATTGGAGTTCTCTGCACCTTCCAGACACTTTCAACAGGGTCTTGTTGCCCGTCACTCTGCACAACCCTCCATCTGATACT
TGTACGTGTCTGCGTTATTTGAACTAGTTGGAACACACAAACTGTAAGTCCGTCACAGGCTGGTGCATTCCTGAAGCAATAGAgtttcttcacagcagct
tccgGACCAAGTTGCAGGCCGATACGCAGCAATCTCTGCCCTTCATTTTCTGACAAAAGTTGTAACTCCTCGACGAATTCAGTAGTAGATGCAGGCCATA
CAGCTACTAAATCTTCACTCCCAATACTTGTAGCACTAGGGCAGCACTCTCCTCCTGGGAAGTTCGTCTTAGTACCGTCAAGTCCTTCATTATCTTCCAA
TAAatagcaacttcaacaagaccTTGAAGTGAATATGTAGcattctgattggttgaaaaaaaACCTATCTACAACGATTAGGGCTTTGGCGCGCGCAACT
TAATGGCGCCAAGTCATTCCTAACAAAACTCTAAGGAATCAATTCGACCTCTCTCTGTGGAGCTGTAGAGAGAA