Description :
Non Conding Region
Location :
scaffold_1:99260- 99478
Sequence
218 bases(100 bases per row)
CCAACGAGGTGGTAGTGCAAGTGCACATTCTGGCGTTACACTACTGTGCGCGTAGTGTGGTGTGAATGCTGCTGTGAAAATGAACTGCCGACCGTGTTGT
TCCTGCTTACGAAGAGCTATTCTTTACTGCGATGGAAACGGGTTTTTTTGTGTGTATTCGGCCCCGATATCGCGACTGGTCGATCTTGTAGAGCCACAGG
CGCGTTCATCGGGCATTA