Description :
Non Conding Region
Location :
Scaffold_1:99165- 100176
Sequence
1011 bases(100 bases per row)
TTGAGTTCCTCCGACACGCCTTCCTTGCGACGCAACACAGCCAAGCAACGCTCACACGCTTCGAGACCTTCACGCAAGTATACCCAGTATGGACTCTCTG
GGAAAATGTACACGGCCGGGGTCATGATCGACAGAATCACCGTCGCCACAAACACCTGCCAGACCCAGCCGACCGAGTTGGCCGACGACGAGAACCATGC
GCACGCGAGGACACCCAGGATAAACCCAAGACCAAGCAGCAACAGCGCCTTGCCGCGCATCTCACGCGTCGCGATTTCGTAAATGTACATGGCGAGTGTT
GGCAGCAAAATACCAATCGCACAGCCGAGAAGAGCCACACCAGGGAACAGGAAACTTTCTCCAGACGCCTGTACGGCACTCACCGAAACCATACCGAGCA
TCGCAAGCACGCCACCGCAGACAATCGAGAGGCGTCGACCGATGAACAAGTTTGTAAAGCCAGCGATGAGCGAACCACCGACACAAGCAAACAGGAAAAT
GTACGTCGTAGTACCATTGCCAGCCTTGCCATCCAAGAGTGCGTACGTCGTCACGTAGCTAATAAAGCCAGGCGTTGATTCAAGAGTCGCGAACAAGTGG
AAGATCCAGCCGCAGCCACAGCCACCGAGCATGCCCATGAACGCAGCAAGCGAGAACGCGTACTGCGACGACGCCGACACGACCTCCGAGAAACCCTTGT
TGTACATCATACGCGTCTGGATAATGTTCAAGAACGGGATGCCCGACATGATAAACAACGGGATAATCATCGCCGTGCAAAACACAAAGTCGAACAGGAA
CGCGAGTTGCTGGAACATGGCGACATTCGCGATCGACGAGTTCTTGAAGCTCCACATGCGGATCATCTCGTTCAAACCGTACAGACCGCCCATGTAGCCA
AAGAAAATCGCCAGCGCCGAGCTAATGCTGGCATCCATGACGACGCGCGCAACGACGAAGTACCCAACCAAACACGCGACGATTGTCGCCAAGTACAAGC
CGGCACGCACA