Description :
Non Conding Region
Location :
scaffold_1:99135- 109830
Sequence
10695 bases(100 bases per row)
GCTGCAGCAATGGGCTGTTTTTCGAGTGCTGAGCGGAGTAATGTCGTGCAGTTATTCGAAGCTGTGCAGTCCAAACCAACAATCTGTTCCCAACCAGTAA
TACTCGCGGCTGTGCTATTTGAACTAAATGAGCAAACAGATGAAGAGTTCGTAGCTGATGAACTTCCCGAGCGGCTTCATCAGCACTAACAGTACACACT
GACGAAGAGTTCGTAGCTGATGAACTTCCCGAGCTGGAGTCGTCATACGGCATTGTGAGCTCAGTAACAAGACCCCAGCCATTCTGAGCCGCGTCCTGAA
AAGCGGCGTGAGTCATACCACCATTGCATCCGTCGTTATGGGACTCCCATTTGATTTCCGACTGCATCCAGCTGGCACCGTCCACCCCGCTATCTGAAGC
CCAGCAATACTGGAATGTTTGAGTTGTCCGCAGTGTGCTACATGTAAGGAATTGCTGTGGGGACAGAGCTACGGCTTTTGAGGAGTTCTCTGCAATTACG
ACGGCGGTCTCGATTGCATCGGCAGCTGCGAAAGACCAACAACTCCCGCAGCTCTTTTGACTCTTCACGGACGAACACACGCTATACCCCATCGAATTGC
TTGTGTCACACCAATTCCAGTACGTTGAGGTTCCCGAAGTTGACGCCGTGGAGCTATTTGTTTCAACCTGAAGACGGCGAGAGCGAGCTGAAGCCACTTC
CTGATCCACAAACTGCTCGGGTGTCAGCTCTCGGGTCGCTGATGAAGTCAAGTGCCGCTCATTCACGCCCATGTGATACGAAAACTCATGACCAATTTTC
TTCGCGTACTTGTTCACGTCTACAATGCACAAGAGCAACTAACATTAGCGTTCGTAGTCGTAAGCATCTACCTGATGAACTTTCGGCCTTACCTTCTATG
TGTGTCATGTGTGCCAGCAAGTTACGTCTGCCTGACTCAGTGTCGCTTGAGTCAACGTAGTAGTGTTGGATAAGAAGTTCACGCAGCGTGTGAGCGTCGA
CAATCTCGCCATTCTCCCCTGCCCAGAGACACGATGTATGCACGGCTGGGCAGTCCACCAGAGTGCCCAGAGATCGGTCCGTCATTTCAAGAGCATTGAC
GATACCAATCATCCCAACCGCCACGAGAACGGCAGCTTGAATGTGCATCTGGTTGCGCTCGAGGTGGCAAATGTTTCTTTGGTACAGACTCGTTCCTATC
AACTCGTGATCACTCTGGTGTCCACGTTTACGAGGTGCTTTGGTTGTGAGTCCAACTCAGTGTCCGTAAACTATAAAATGGCCAGAACTCGTTGCTGGGA
CACAAATGATGATGGCGAAATCAATCAGCACGCAGCTGAGAAAGCGGGAAATTGTGCTGGGAACGCCTCAGCGAAACCATCAGCGCTCAAGTAGCGCCGA
GCCATATCCAGAATAGCAGTACCCATTCTCAGCATACAGCAAGTTTCCACAGCAAAAGGAGTCTGGTCACCAGGGCCATCTTCTGGCATATGATCTACTG
ATCAGCGGGACCGTTCTCGGTGATAACTTTTCGCTTCTGGTACCACTGGTGTTACGAAGGTGCAAAAGGCGACAATATGGGCAGTATTAGCCATCGCCGA
GCAGGAAACACAAGACCTAGAGAATCAATCTTTATCATCCTAAGTACTCAATTGAAGGGCTGGTAATACTCCGTTTGAGTGTAATCATTGACCGTGATAG
GTTCATTCGTGCTGTCCTTGCCCTCTGCTGCTCTACAGGAGCTGCTAACAACAAGACCACTCAATTTCACTTAATGCAACTTTGTGAATGATTCAAAACG
CGTTAGTTCCTGGTTGTTCTAGGCCGTGCGCTTGAAGTGGTCCTCATCAATTGTCGAGTACACATGTCCTTCACTAGTGAGATAGTTGAGTGCACTGCGC
AATTGTTGCTCCGTCATCTGTCCACGAAGGTCGGCGAAAATCTGGTCGATCTTGAGGCCGCGGTCGCTGGTGCACGTGCCCAATACATCCAAGATGGCTT
TCTGTTCTGGTGAGAAGTTGGAGTCCATCATACCGTAGTCCATACCCCCTCCAAATCCTCCAGCACTCGGCTGGTTCCATTGGTTTCCACCAGGTGCAGC
CTTCGTCGGTGTGTTAAACGACGTCATAGTCACGTCGGCCTTGCCGTTATTCAGCTGCCCCTTCGTGTTGTAGCAATGCACGTAGATGGTCTCCAGAAGA
TGGTGCGTGAGCTCATTCATGTCTTCCACTGGAGTCACATTGAAGCACGACAGACTAGCTTTGCCCTGAAATGTGCGGAGTTTTCCCACTACGCGGACGT
AGCTGCCGTCGCGCAATCGGTTCATCTCTCCCTCACTAGCATCAGCGTCGTCCGCCGTGACAAAGTACTGACAATCAAAGGCTCCTGAGCCGTCATCCAA
CTGGAAGCGAAGACTCGTGGAGTGTGGCGTGAGGTTCGTTAGGAGTCCAATGAGGCGCACAGTGGACACTTCCTGGCCGTCCAGACGTAGCGTGTCATCG
TCTGCGTTCACTGTCTGTAGCTGCTTGATAGAGACTGGAAGGATGCTCTGAGCGGCACCACTGCGCTTGGTGGGCGTGGACTGACTGACGCCGGGCTGGC
TCGACATAAAGCCACCCCCGCCATTGCCATAGTCGTCGTTGCCGTAAGCTTCGTAGCCACCGCCGTAGTTCATTGGTTCCACAATATTAGGGAAATGAAG
ACTTTTTGGCGCCAAAAGTGAGATAAAGTACGAGTTTAGAGGGCAGATGAAGTAACGAGGTGAAGTAACGTTTCGTCAAATGGCTACATGATATGACTTC
AACATGATCATCTTCCAACAAAATCAAATTCACACATATTCACGACTGCCAGTCGTCATGCAGACTAGCAGCTCCATATAATGCTATTTGGCTCACTTGA
TGGAGCTCAGTTACATGAACTCCAATGGATCCACCATATTTGCTGCATTTTCCAACTCTTGATTGGAATCCGCGGTTGTCGCTTGTTCACGTAATTGCTG
CTCTTCTTTGAGTGCTGCCATCTCCTGTAGAATACCTAGTGTGAGTGGATGATTGGCCATCCACATTGACTCGCTCTCTCGTTTGTGACGACTTCGCATC
GCATCGCAGTTGGTGGACGTCGCCAGAGGAAGTGGCAACTTGCAGTCAGGGAAGCGCTCGAGGGCATCGTTATGAACGTACTTCCACATAGCATTCTCAC
CCTTGAGCTGCTGAAGAGCAAACAGAGCAACAACTGGACCTCGATACCACCACCCTGGATGCCGTGGCTTCTGCGTATCCAACCTGACGAAGAATTCAGC
TCCAAATTCCTTGTACACGTCGACGATAAGCGATTCAAACGCATTCTTGGCCGTGAGCTGCCGATTGTTTCGTTTGTTAAATGCTGATCCATCCCGACTA
CGAGATATAGGAACCCAGAACTTGCGCTCCCACACAGCGTGCGAATGCTTGTGCCAAAACTTGCGGAACTTTCTCGAAACCTCAGGGTGATTTTCCTCCT
CAAATGGTGGTGGCAAGTTGCCATACACCGCCTCCCATGGACTCTGCGCAACGAAAATCTCCATTTTGCACGCCAGCTTCAATTGACTGCGGAGTATTTC
CTCACTCATCGTGGGCTTACCTCTCGTCTGTGACTTCTCTTTTATCAAGTTTTGCTTTCGACTCTCATATTTGCGCTTTCGTCCTCCCTTACGCGTTGGA
GATAGTTGAGGTAGTTCTGGTGAAACTCCAGCTTGTTCCGGCGCAGCTACAGTTCCTGTGTACTTCAGTGCGTTTACAGCTCCATTTTGTTCTGGCGAAA
CTGCAGTTTCAGCTTCCCTCGGGTCAACTGCAGATCTAGCTTGATCCATTGCAATTGCAGCTGCTTCTAGTAGTGGTGAAACGACTCTGGCCTTGGTCCT
TTTGCCACGTTTTGATGTAGTAACAGCTACAGCAGCAGGACTTGAAGCTGGATACACGCTCTTGTCTACAATAGCCATACTGTCAGTCAATTCACTGGTG
GAGAGGACAGCACCGTGGTTGTGCCGTCGCTTATTGACGTCGTCAGGAATTGCAGCTTCAGAAGCAGCATTGCTCCTCATCTTCACTGAAACTCTCCCCT
TTCGTTTTTTTTTCGCTTGTTGTACTACCGTCTCCGTAACTTGCTCCTGTTCCGCTACAATTTCCACTGCTCGAGGAGACTCCATTCGAGTCGGTGGTGG
ACGCATCTGTGGCAGCTCAAAAGGGATGACACTGATCACTTGACACCCTCTCTCTACGAACGCGAGCAACGACGTCTCTTGATGGTACACGAATTCCAGG
AACAAATGTTTAAGCAGCGCCATATTCCTGGTCGCTACGCGGTACTGCAGATAGAGGAAGACGCATCCACGAGTATCGAGGTGGGATTTCGGTTTGGTCA
GCAAAACTTCCGCTTGGTGACGTCGTTTGGCGCTGGTTCTCAGCATGGGGAAGATGGTGATCATGGTACAGCCTTGCTGCATCATAGGCACTAACGTATT
CTCGTGTACATTGAGAAAGTCGGCAAAAATGCGACGCAACATCGACAGGTTCTGAGACTTGAGACGCAGCTCCAAATAAACCGCGAAATCCTGCAACATG
TCATGATCTCGAAACACCGAGTTGGGTGGAGATTTACCACGACTCACGTAGCCATCCAACGTCATGATTGAACGAGCTCGCGTTGTCTGGTCCGAGAACT
CGACAGGGAATGCCATGGTCTCCATTAATGTCGTTCAAGAATGAGACGGAGTTAATCGGCGGGAATTGGCGTTGGACACCATGCTGTGTGGGACCAGGAG
CTACGTACTTTGATACCAGTCTAGCCATGTGTGAAAGCTTCGTGCGAGGAGTCTGGACTGATGAAACTCTTTGGCCATTGCGTATTTGCCTTCTGTCTCC
ACGATTTTAACTGCTCTGTCAAGAGACCATGGCGTAATAGAGTGTTCGATCCGTTGTTGAGCTCGACGGCAACGAAGTCGCAGCTTGACACGTTGAGTGA
CAACTCGTCGCCATTGACGAAATGCTCTTGATCGACGACATCGAGTAGATAGTTGAATAGCAACCGCGAGTTGATTTGGGCCTCCACGGTACAAATAGCG
GTAGAGATAAAGGCGAGTGTATCTCTGGAGGACACACGCTTTCACTGCTTGATGCGCTAGTAGAGCTACTCGACTGAGTATCTTTGGACTTGGTGGAGAT
TTCTTGATAGCAGAAACTTGTAACGGAGGTTGACAAACTACTCGAAGCTTGATGTACGGAGTTCTAACCCGCAGTCGGACCCGACAGCGTTTTACTTCTC
TCTGGTCCACTGGGCGAAGCTCGACACCATTCACTTCCCCTCCGAGCAGCTCCGACGTCAGTTTTTCCAAAGCTAATGACTCACGCTGGTACTCTCGTCT
TACCGACGTGTTTAGTACCATTAAGTCACTGTTGATAAGTCGCAAATGATCGTCGAAATCCGAACAGAACGCAGCGAGTGAAGCAGTGAATCGACTTGCA
GATTTAGACCCAACAGCACGCACTTGTCGCTCTTGGTTCCTTGGGTTCGAAGGCCGAATCGACACACGTGCTTCTTCGTGCTGTCTAACAGCATGTTTCC
TCTGCAAATACAGCCTCTTGGCACGAGCTAACGCGGGGAACGCAGCCACCTCGGACATCGCCACGACGTTTCAATACAGAGAATAATTTTCCTTGAAATT
GTAACTCAATGACGTCCCTCAAGTTTCATTTTATTATAGTCTTGATTTCATCATCCGACCGAGAGCTGACACCCGAGCGTTTATACATCAACAAGTGGTT
CTCACCATGGAGATTGTGTGTGCTGGTAGGCAAGGAAATCGGTGTTTGTTCAGTTAAAATCGACACGAATAAGTTGATCATAGATTTAAACTAAGCGGTC
AAAAAAATATTTCAAGACAGCACCTACAAACGAAATGCTGCAAGGTTGGAAACGAATGGATCGTAATTGAGGACGATCTTGTTGCTAGTCTAGAGAAAGG
TGTAGTCCTAACGTTTTCTTCACACTTTGCTGACAAACTCACCAAGACTGAATTCGCTAAAGAGCGTCGAGCAAGTTTTTGATGATCTTGTCAAGACTAG
TGTGATACACGTGTCGTCTCAGTGCCGACTGTATGGAATACCCACCCCCAAAACAGTGATGAGCTCAAGCCATCTGATCTTCTTATACATCACACAAGAC
TCAAAGCCGTAGAGATATTGGTGGATATAACCAAGCTAAAGAACAGACCTGTGCCATTTATTGTTTTGAAAACCTTGAACGTGCTTACCTATAATAATGT
TGACGCCGAGACGATGACCAGCCCACACAGGCGAATCCAAGTCTTTCAACTACGGGCTTCGTTGCTTAACACTGCTTTATTGTTCAAAGAATCAATTACG
AAGCTACAAAACCCCACTGGATTTGCCACAGTGCTCGTCCTAGGGTCAATTCACGAAATAGTCCAAGTCCTAGTGTGACGCCATGTGCTGGGCGTTGGCC
GGAGCACGGGCTGCGTACATGGCCGAATTTTGCTTACGGAGCGTCTTCATCTTCCGCTGTGAAATCAGCATACCGATGGCAGTCATCACGATCGTGAAAA
TAGTCGTCACAGCTGCCACAGCAATCCAGGCCGACGGGCTAAGTCCAACGAAGACCTTGTCGCCACCGCTATCAACGCTAGTGGTCGCTGCAACACCAGC
TGATGCACCCGTGGGAATGACAGGGAAGATATTCAGTCCACAGTTTACCTTGGAGTCTGCCACCAATTTCATAAAGCCGCTAGCGCCCCACGAGCTACCG
TATGAGTTTTTAAGGATCCAGTAGTCGCCCTCCGATGCATCCGTGCCGTATCCCACGAGAACCAGAGCGTGATTCACATCGTCCTTCGAAGACAGGTCAC
CATCGTTCGGACAACTGTAGAAACCACCCGCGTAGTCTCCAAATGGATCCTCCGAGTTAATAGCCACAGCAATCGGCTGCTTCTCCAACGCCGTGCGCAG
CAAGATCGTACAGTTGTTCGAAGCGGTGCAGTCGGCACCAACAACTTGTTCCCAGCCTGTGATGCTTGCCGCCGTTTCATTGGCACTCACAGAGCACGAC
GATGACGCATTGTTGGTAGATGTACTGCCCGAGCTAGAGTCGTCGTACGGCATTGTGAGTTCCGTCACCAGACCCCACGAATTCTGCGCTGCATCGATGA
ACGCACCGTGCGTCATGCCACCATTGCATCCGTTGTTCTGTGACTCCCACTTAATCTCCGTCTCCATCCACGTAGCTCCGTCCACACCACTATCTGATGC
CCAGCAATAGTCGAAGGTCTGCGTCGTCTCGAGTGTACTACAGGTCAAGAATTGTTGCGGAGAGAGCGACACCGCCGCCGATGCATTCTCGGCAATAACA
ACAGCCGTCTCAATAGCGTCAGCAGCAGCAAAAGCCCAGCAACTACCGCAATTCTGCTGACTCTTGACCGACGAGCACACACTGTAGCCGAACGAATTGT
CCGTGTCGCACCAATTCCAGTATTCAGAACTTCCTGCACTCGACACTGTGTTGCTCGAAGTGGTTGTGCTGCCACTGGCCTCTGACTTGAGGCGACGCGA
GTGTGCTGACTTGACTTCCTGGTCCACGAGCTGTTGGGGCGAGAGGCGACGCCTGGTGGACGACGTCAAGTGGCGCTCGTTCACTCCCATGTGATACGAG
AACTCGTGGCCCACACTCTTTGCATACATGTGAACGTCTTCGATGTACGTCATGTGCGTCTGCAGGTTGCGGCTCAAGCCATCGCGGTCGCTGAACGACA
CGAGGTTGCGCTGTACAAGGAGGTCGCGCAGGGTCTTCGAGTCGACGACCTCGCCGTTCTCGCCCGCCCAGAGGCACGGAGAATCGGCTGAGCGCGCGGC
GGGGCAGTCTACGAAGGCGCCAAGAGAGCGATCCGTGGTGTGCGCGGAGGCGGTGGCTGCAGAGAGCACGACGAGTGACGCTTGTACGCGCATTGCGGTC
GAAGCTACGAGCGGAGGGATAACTGAGATAATTGAGACTGGCGGCGGCTGTCTCTTTTTCTAGGATAGGAAAAGTGCTTTTTCAAGCTGCTTTTTGCAAT
GCATGAGCGATCCACAGTTATACAAGCCATGGCACGGTGAGTTGCAAGCGTGCTTTGCATGCTGAGTCACACGGTGAGCAGAGACACCCGATCAAAAGTG
TTGTTTGGATTCAAAACCCGAGAATCCAGGTCTCCGTAGAAGTGCCGTGGTCGCTGAGTCACCAGCTGAGCAAGCATGAGCAACATGAACGCACTACGGG
ATCTCATGCTGCTCATGCTTCTCGTGAATGCACTTGTATTTTAGTAGACCAGATCCAGAGACTGCTGCGCTTGGTGGTCGCCATCTTGGTGGTATCTCGC
GGTGGAGGCAGAAATACCGCCACACTGCTTTGTGTTCTTGCAGTCTGGTCAATGCTTTTGCATCTGTAGTGAGCTCCGTCAACTACTTTACTCGGCGTCA
TCTTATTACAACTAGCTAGCTCCGATAGTGCTCGTTGCCCAGATGCCAACACGCTCGAAATGGTTTCCGCTCTCCAGCTGGTTCCATCTTTGCAGTCGCG
CCAAGGGATGGGACACAACCAAGCAGCGCAGTCATTGCATCGATGTCATGCTGGGACTTGCTCGCATTGCAAACCTGCCCTGCCAAAGCCAAAGAGAACG
CCGTATCTAGAGACGCTTTCGTCGTGGGTGAGTTTGCAATCGCGAATGATGAGTCCGGGCAGCGAAACAAGACGTCGGTCATGCATAGAGGCGATGAATC
TCGACCTGCTCGATGCTTGATTGAAATTTCGCAGCCAGATGCGGCTGCATGGACTTCTGCCTAGCCCGCTGGTTAACAAAGCCAAGGCGATTTCGCTGCT
GTTGTCTGCACTTTCGACGGTACTGGACGTAAAGCTTGGCGCGCCAACACTTCATGGTGTTCAACAGCGGGCAAAGACGGTCAATTTGAATCATGAGCAG
CAGATCCGATGCGTCCCTCCTCTCCAGCAGGCAGTTGACGCCGTCAACTTGACGGCCGGTCCTCAGCCATCGTTCCTCCCTTACGTCATTCCATTCTCGG
ATTCGCAGCCTCCTCCAACGCCCAGCTACCAACAGCACTTTAGACTAGATTTTAGACGACACTACCCGACGATGGCGACCCAAGCAGGAGTGAAGGAGGA
GACTCCGCTCCAGGTGAAGACAGTGATCGAACCGCAGTGGATCCGCTTCCTTGCCGGTGGTGCAGCGTCAGCCACCGCCGAGCTGCTGACGCTTCCCATT
GACATTACCAAGGTGCGACTTCAGGCACAGCGTTCCGGTCCTTCGACGGGCGGCAAGCCAGTAGTACACTACAATGGCATGCTGCATGCCGCACAGACCA
TGATCAAGCAAGAGGGGCCTGGTGCGCTCTGGAACGGTGCCACGCCCGCGTTGTTGCGTCAAGTCTCGTACACGAGCATCTGCATGGTACTCTACGAACC
ACTTCGCAACATCTTCGGTGCCAACGCAGTCCAAGGCGCAAACGGTGAGGTACCGTTCATCAACAAGTTCCTAGCTGGAGGTTGCGCTGGCGCTATTGGT
ATCAGCATCGCCAATCCGTACGTTGACAACGCTGATTTATAGTTTCAGAGTTTTGTCTGATGACTTTGTTGCTGCCTTCGTAGGGTGGATGTCATCAAAG
TGCGTATGCAGGCAGACCGCACGGGTAAGCTGTATCGTGGTGTCGGTGACGCTTTTAGCATGATTTACCAGCGGGAAGGCTTTCGTGGGTTCTTGCGTGG
TATGCCACCGAACATCCAGCGCGGTTTTATTGTGAATGCTGCCGAGTTGGGCACGTATGACCACAGTAAGGAGCTGTTGATCTCGTCTGGTCTGCTCAAG
GAGGGCGTATTCGCACATACTGGTGCCAGTTGCGTGGCAGGCTTCGCTGGTGCTGCTGCTTCAAACCCGTACGTTCACTGCTCGCTTCCCGAAGTTAGGT
ATTGTGAAAGACATTGTATCTGACCCTGTGCTTGGTGGATGTCGTCTACAGAATCGACGTGGTGAAAACGCGTCTTATGAGTCAGCCGACAGATGCGAGT
GGCAAGGGACTTCACTACAAAGGCATGATGGACTGCGTGAGGAAAACCTTCCTCGAAGGTGGCGTAGGCGCCTTCTACAAGGGTTTCATCCCCAACTGGA
TGCGCAAAGCACCCTGGTGCGTGGTCTTCTTCGTCACTTACGAGAAGTACCGCGCGGCGCTGGCACCCAGTGACGAGGAGCTATAGACTGTAGACTACTA
GCAAGTGCTGCTGGGTCAAGGGATATTCTTATGGCGACGAGTGTAGCTAGCAAACACTTCAGCATGAAAGAAGCAATAGGATATCACACATGATTTCATC
TTGCGATATATTGAATGATTGCTGAACTGCTTTCACGGAGTCCACTGCTGGCACGCTTCTCGCCGCACATGATAAATAAGAATACATTCCCCTTTCTAAT
GAAGGCACAAAGCGCGTATCTCGCGGGGCACCGCAGCGACGATCTCGAGGAAGCTTCTTTTTCGCTTTTCTCAGTCTGCATTCTCTTCGACCACCAACCA
CTACCTCTGTGGGTAGCTCTTACACAAACCATCCTGATCCCTTCAATTCTTTTTCTGTTGCATAGTTTCTTCAGTCATGGGGCATACGTGCTGTT