Description :
Non Conding Region
Location :
Scaffold_1:98939- 105413
Sequence
6474 bases(100 bases per row)
AGCGTCGCCGATTGAGCGACTGAGCGGCTCCCATCGACGAAGAAACCCGCAGCATGGTCGGCTCCACCTAGCCGAAAGCCGCCGAATTCCGATCCGACCT
GGCGATGACAGTGCTGAGTACAATCTCGCGCGCTGATTGGTTCAAAAATCGCCTAACCGCTTTGTGCACGTACTGAAATGTGGTATATCTGGTGAGTTTC
GTTCGGTTTCGTTCGTAAGCGGCAGTCCACTAGGTATCGACTAACTATCATCCGGATGAATAGATAACTTTCTATCAATACGGTATAGCGCGTGAATAAG
AGCTCCAGGTCTATGAGCAATTTTGAGAGGGGTTGCATACATAGAATAATAGAACTGCAAACAAGCACTCGCTTTCTATACGATATTTAGGTACCTCTCA
CACTAAATATCATGAGATCTAAAGATAATCAAATCACTCCGCTCCTATTCACCCACTATTGTGCCTACCTGCAAGGATGAAGCAAGCCATCATCATGCGA
CGAAGCAGTCGCGGAGCAGTACAATCAGGTGGTCGTCGCTGCGCAGCGTGGCCCGCAGCGCTACACAGTAGGCGGCTAGGTGCTCGATGGCGACGGCGCC
GTCGCTCGAGCCGGGGAGCTCGAGTGCGAGCGCGAACTCCTGGAACACCTCGGCGGCCGAGGAGAGGCCAAGCTTGACGCTCGGGTGGTTGGAAGCCTGG
AAGCTCTTGGCCAGCGCCGCAGGGAACACGCGACCTCTGCCTGCCGCTTGCAGCGACGAGAACAGGCGCTCGACCGCAGCCGCACATTGCGGGCTTAGCA
CTCCGAACAGACTGTCGAGTAGCACGCGGATGGAGATCCGGTTGAACTGCACAGCGCTGACGCTGTTCACGCGCTGGACTATACGAGATGGCTCAACATC
GACGCACTGGCGGAGGTAGTCGAAGAGCGAGACGCAGTGCGCGTCGGTCAGCGAGAGTCCGAGCGCGGCGTTGATGGCCTCGCGACAGTGCGGAGCCGCC
AGCGTCGCCGTCTTGGCCTCCACGCTCAGCTCCAGCCGCTTGCGGAGCTGCACGACCTCGACAACGCTCTTCTGGCACAAGCATTGGCGGATCACGTGCA
GCACGGCATCGCCTGCGCAGTCGGACGTCGATGCGATCGGAACGGGTGCCATGTCCATCTTGGCGCCGTTGGAGATGTCCTTGAGCGACATGATTCGCTT
GCCGTTCGTAGCATCGCGACTCGACGCCGACGACCGCTTGTCGGTCAGGTCGAGCGTGGTCGTCATCGCGACGTGAACGATCGGGTTGCTGCTGCTCGCC
TGCTGTCGCTCCTGCTGCTGCCGCTCCTGCTGCTGCAACCGCGCACGCACATCCTGGATCTTGACGCCCAGGTCGTCCTTGACCTCCTTGACGACGTCCG
TGCCGTCGGCGAGCGTGACGAGCACGCGGCGCGTCGTCGAGTTGGCGCACCAGCCCACACCGCCCGAGATGTGCCATGCGTTGCGCATCATGAGCTCAAA
GTAGTCGTCGTCGTCGATGCTGGCGCTGATGTTGTGGTAGTAGTGGCGCCATTGGTCCCACGTGACTTTGCCGTTGTGCGCACCTTCGACGTCGAACGTC
TCGAGGAACTCGCGACACACTTGCTCGGTCGTCTTGCGACCCGAGAGCACGTCGGGGTGCTGGCTCGCGTCGTAGCCCTCGACGATGTCGCTCGGCTCGA
GCAGTCCGTTGCCGTCCTTGTCCATGCGGCGGAACGCCTCGCGCACGAAGCCCACTCGCCGCTCGTTCATCGGGTCGCGCACGCCGCCGACGAACTCGTT
CAGGTCGATGCTGCCGTTGCGGTTCGAGTCGAAATACTGGAAGAGCAGCCGCACGTCGGCGTCCGGGACCGCGAGGTTGCACGCGGCCACGGCGTTGCGG
AACTCGCCTAGGTTGAGCGCGCCGTTGCCATCCTCGTCCATGAGTCGGAACTTCCGGCTCAGTCCGCAGAATCCGTGAGCGCCTTGAGTCTTCAGTGCCG
CCTTGACCTTGGCCAAGATGGCCTGCACGCCTGCTGGAGGTTCTCGCGTCGAGGGAACTATCGGCTGCTGTGGTGCTGGCCGAACAGCAGCAACAGTGAC
TGGAGCAATGCGCTCGTTGCCGAGACAGGCAGCAATCGCGTTGCTCGCGTTATTATTGGTCCGGCGGGGAGGCTGAGTGGCTGGTTCTTGAATGGTGGGA
CGCATCGTGTGGTCCAACACGTCGTAGAAGCTGGTGCGAGTCACCGAGCGTCCTGCTGCCGCCGCAGTGGCCGCCATGAGTCGCGGCACGTCCTCGCGCT
TGACGCCTAGGTCGTTGGGAACCTCCTGCACGCTCGCAGAGCCGTCGGCGTTGGTGACGAGCACGCGGCGGTTGGACGAGTTGGCGCTCCAGCCGTGGCC
TCCGGAGATATGCCACGCGTTGCGCATCATGAGCTCGAAGTAGTCGTCGTCGTCGATCGCCGCGCTGATGTTGGCGTAGTAGCGCGTCCAGTCGTCGAAG
CCGACCTTGCCGTCGCCCTGGTGGCTCACGTCGAACGTGTCGAGGAACTCGGCGAAGACGTCCTCTTCCGTCTTGCGACCGGACATGACCTCCGGGTGGC
GCCGCGCGTCGTAGACGTCCACGATGTCCGACACTTCGAGCACGCCGTTGCCGTCCTTGTCGAGCAGGTCGAACGCCATGCGCACGAACAACATGCGGCG
CTCGTTCATAGGCTCGCGGATCCCCGAGAGGAACTCGTCGAAGTCGATCGACCCGTCGTGGTTGGCGTCAAAGTAGTAGAACAGGTTCTTGGCGTCCAGC
GGCGGAAGGTGTACGCGGCTGTCCCTGAGCGCATGCACGAACTCGTGCAGGCTGATGCTGCCGTTGCCATCGCTGTCCATGGCGCGGAACTGGCGCTGCA
GCGAGATGAAGCCGACTGCGCCGAGCTCTTTGAGTGCGAGCCGTAGCTGGTGGATCACGCGCCGCAGCTCCTTGGACTGCTTGCTCGTGCTGTACATGTT
GGCAGGCGTCGACGCGGCCAGCTGCTGACCTGTCGGCGATAGGAGTCCGAAACCAGCACCGGTAGCCGCACGCTCGTGGTGTTGGTCAGCCAGATCCGGC
TGCAAGATGGTGAGCGCCTGGTGGCTGCTGTGGCCAGAACCGCGGGAAGCCTTGGCGCTGTGAGGGCTGATCACGCTCGGAGACAGCATAGGCGGAGCTG
CAGACGCAGGCGCAGGTGCGATCGAGGCCATGAGACTGGCGGAGAGCTGCCAGGTGTTGCGCACCATGAGCTCGAAGAAGTCGTCGTCCGGCACGAAGAA
GCTCACGTTGTGGTAGTACTGCTCCCACTGCGCTGGCGAGACCTTGCCCTGGTTGGCTGAAGCCGACGCCGAGCCCTCCTCGAGCACGTCGAAGTTCTCG
ACGAACTCCTCGAACAGCTGCTCCTCGGTCTTGCGCTGAGCGATCACGTCTGGGTGGCGGCTCGCGTCGTAGCTCTGCACGACCTCGAGCGGGTCGAGCA
GTCCGAGTTTGGGCTTGTCCAGGAACTGGAAGGCGAGTCGCACGAGCTGCCGGCGCCGCACACCCATCGGCTCGCGGATGAGGTTGAGCACATCGCCCAA
CGGCACGGCTCCCATATTGCCGCGATCCAAGTGCTTGAACAGACAGCGCAGATCCACGTCGCTCAATTGCTGCAGTGTCGGCTCGGACTTGACGGCGTTC
TTGAACTCGGCCAGCGACAGACACCCGTCGCCGTTCTCGTCGCTCAGACGCAGCGTCCGCGTGAGCGCCACCAGTGCGCCGATCCCACGAGCCTTGAGGC
TGGCGCGGAGCTTGGCGAGCACTGCAGCAGCGCCAGCGTCGAGCCCAGCAGTCGCATGCTGAGTGGCGACGGCTTTCGGCGAGGTGACGGGCGAGAGCGA
GGCGTCCACGAGACAGGCGGCGAACTGCGAGCTCTTGAGAAACTCGGTAGTCGTGGTGACAGTCTTGCGACTGGCAATGTCGTCCTTCTGGACTCGTCCG
ACCACAGGAGCCGGTGGAGGAGTCGACGCCGACAACACTGGACGGATCGAGTCGCTCACGGGGATGCGGTTGTCTTGAAGCGCCTCGAGCAACGACATTG
GCACCGCGGAGATCTGTCGACCAGTGGTGACCTCGTCCAGCGACTGTCGCGGCGCCGCGCGCCACACGCGCTTGAGCAGCAGCTCGAAGTACTCGTCGTT
GGGGATCTGGCCGCTCATGTACTGGAAGTAGGTCATCCACTGGCCTAGGCTCACGAACACCGTGCCGCTCGCCGCCGCGGTCTGGCAGATGGACGCCTGA
AACGAGTCGCGGAACTCCTGCTGCGCCTGCGCGGGCGTCTTGTCGCCGAACATGACTCCCGGATGCTTGGCGGCATCGTGTGCGCGCAGCACGTCCTGCA
GCGGGACGTACCCGAGCCTCTTCTTGTCAAGCGCGTCGAACACGCTCTGCACCAGGTCCAGTCGCGCTCCAGTCAGCGGTCCCTGTTCGGTCGATCGCCC
AGTTCGTTAGTTGTGAGCAATCCCTCGTGGCGCGCAGTTCCCGCACTAATGACTCACACAGAGCAGCGTCTTGACGTCGTCGACCGGCGCTTTGCCCTCG
TCGAGTCCGCACAGATGTTTGACGACCGCGCGCGCGTCTACGTCCGAGATGTCCAGGCGGCTCTCGGCCAGTACCCGCTTCAGCGTCGCCTTTCCCACGC
CGCTGCTCTCGCCGCCAAAGTGCTCGAGGCTCAGGCCGAGTCTCACCCACGCCCTGTCCAGACAGCCAACAGTCAGATCCTCAGCATGCAGAGGCGATAA
GAGGGAGGATCCAAGCGACGACGTACATGATGCCTTGAGCGCGCAGCTCGGCGCGGATGCGCTCCAGCAGGCCGGCAACATCGATCTGGTCGGCCGACTG
CTGCTGCACGGCGTTCCACTGCGTTAGCGACGTCGGCGCCGCCATCGCCATCGCCGTCGCGAGAGTCTGTTGCTGTTGCTGTCGCAGCATCGCCATGTTG
TGTTGTATGCCCCAGTCGCGGTGGGGAATCGCCAGCGCTCGGAAGAACGCGAAGTTGGCCGCGCATGCCGGAGCGCCAGAGCTTCACGAAGGCGGCTAAA
ATTACCAGGAAAGGCGGCGGACAACTTGGGAACCTTGCGCCGCTATTTTGGCGGCGGATTCTCCGACAGGAATGGGACGTGCCTGCTAAAACTGTCGTGA
CCGCCGCGAGGCCGCCTCAATATACATTCCCCCGTCCATAGGTGGTCGACTCATTCGAGCGAGCGAGAGAGACCGTCGCGACTGCGGTCAGTCGGTCGAT
TGAACAACGGGTGCGTCCGCCAAGGGCGGGAACAACTGCAGAGTTCATTAAATTACTAGGCGGCGAGCCGTCCATGCCTCCACAAACTGTCAACCCGCTC
TATCGGCTCGAGTTGTCTGCGTCCTAGTGAGCCGGCGGCAGCTGGCGGTCGGACGCCGAGCGCCGNNNNNNNNNNAGCCGGTGGTCGTCCACCAGCGTCA
TCCGCTCCAGGCGGCGCGCGGGCTCGCCGTTCTCGCCCGGCCGCGGGGCCAGCGGCGGCGACACCGGGTTGATGGTCGCGGCNNNNNNNNNNGTCCCGCA
CGCCCAGGCGTTCAGCAGCAGCGCGAGCGTGAAGATGGCCTGCATGCAAGCAGCAGTGGCGGCGGCGGCTTTGGCTGGTCCGACGTCCACACAGTCGCCG
CAAAGATCGGGAGGAGGCCACTTTCAGAAGGCGCACAAAAATGAGCGCCTGGTTTTGAGATTTTTCTCAGAGTAGATGGGTGCGACAGCGGGTGGAAAGG
CTGTTTGGAAGGTTTGTAAGCGGCTGTTGGCAACAGAAGGTCGGTGATGGATATGCTGTTCGAGAGGCTTGCACGACTTTCCCTGGGTCTGATTCGTGCG
ACGTCACTGGGTAATGATGCGCAGATGCCCCCGCCAGGCAAGGCTGATCCGGCCGATTGTCTCCTCCTCCTCCGCGCCGTGCGAACGCGGCGTGCGAGCC
AACCGACCGACCGGCGGCGGCTTTGCGTGTCCTGGGAACGCCTCGATTGCGGTTTACCCCCGCGGTCTCGCAATCCCTCCCCTAAGCCGATCGACGGGGG
AAGTGAAATGCTCCTTGCTCTCTCCCTCGCCAAAGCGCAAAGATGCGTTATAACAGGTCCGCGTGACGTGCATGATGGGGTTCGTGGAACAATAATGGTA
CCAAGTATGCTACCGTATGTATTGTACGAGGCTTATCTTGGCGCTTCAAATTTCGCAGCGCACTTTGCGACTTGCGCATCCCCCGGCAGAGCAATCGAGC
GTCGCTGACGGGTTCGCCAATGCGGCCGTGTTTCATTCAGCAACTCCGTCCGTAGTGCCCAAGCCCATCTGCGTCCAGCGCGCACCCGCCCGTCGCGCCT
CAGACGGAAGCGCGGACTTTACGCGCGTGTGCCCAGCCCCCCACGCTTCAACCTGAGCGGGATCAGCCCCGAGA