Description :
Non Conding Region
Location :
Scaffold_1:98840- 99195
Sequence
355 bases(100 bases per row)
GAGCTCTCTGGAATAGACACCGGGCTTGGCATGTTCAAGTTCAGCAGGCATTTAGTCTCCCAAACACGTCCGACGTGCAGAGACGTCGGCGGATAACGCG
GCAGAACTCACACGTGCGCGCATTCGATCGGTTATCAGATCCATCTCCCCGCGAACTACAGAGTCTTTGATACTTCCCGCTTGCATACCCCCGCAGGATT
TCCACCACGCGTGCCACCAAAACCAGCAATACATACAGTACCAGCCAGCCACCCAGCCAGCACTCTTCCACCAATTCAACGACGTCAGCCCAATCCATCC
AATCCAATCGAGGTGCACTCATAAGTTTTCTGCCTGTTGAAGAAATAAAAAGATT