Description :
Non Conding Region
Location :
scaffold_1:98791- 100822
Sequence
2031 bases(100 bases per row)
GCGAGCAAATGGGTCTTGGGGAGCACTGCAAGTTTGGAAGTTTGGAAGTTTGGAAATGGCTACGTCGGGACTGGTTGATGCGCACTTTGGCCAGTCAAAG
TTAAAGAAATGCGGAAAGAAAATGTAAGGAGCGACCTTTAGTTAATGTATCGTGCCCTCAGCCAATGAGAGCGCTGCAACATAATAGTGTGTGGCTACCA
GCCCGCACTAAATACGGTCAAGTTGAAGCAGTCGCGCTTCTCCACTGTAGGCACCGCCGATTTCGGCTAGATCCTGCTGTGTTCCCTGAAATACTCTTTA
TGGGAATTGCCAGTCTCTACCGACTTGGCAACACTGACATGAAGCTGGTGTTGGGTATTCTGCTATTTTGCGGTGGCTTCAACCCTACGACGTAGCCGAT
CAAAAACCTTGCACGCCAGAGTTTCATGAAGGTCAACAGCGAGCTGCAGTTGGAGAGTGCACAGTACTCGAACACCTACGCCCTCAGCGGTGCTTGCAGC
AACCCCGCGCCGAAGCACATGCCTTTCGCCAGCCAGCAGGCTCTCGCGCGTGGTCCGCAAGACTCAGTCCAACGTATGAGGACTAGATCCTCTCTTCAGT
CCACATTACCATGGCATCTTCGTGAAAAAAAAACTCCAACGCAGGTACCAGCCACAGGTTGAGGTCAACTAGTGGTCTCCAGACCAGTAACGCTGGACTT
ACAAATAAGATCGGGTCGCGGTGGCCGCATTGCTTGTCACGCCAATGCCGCCCTCCTTCGCATCGGTTCATTCCTCATTTTTCTTCGGGCCCCAGCAAAC
TTTACCACAGTAAGCCCACTTCTACTCCCCACCGGCATGGCGCCGTCTAAGATTGCGACCATGTGCAGAGCGCTCTGCGCCGTCACCCCTACCTATCTAC
TAGCGAGGTCGCGTGCTTCACAGTAAGATTCACCCTTTCTCGACCTGAATTCTGTAACTTGTCTTACTCAATCGTTCGTGGACAGATTCCCCACTTCCGC
CACCTCCGAGCTTGATGAAGAAGATTCCGCAGACGACGATGAGTGGGGCATCTTGCACGCCCCGACCCAGACGTGCCGTGTGAAATTCGTCACCGAGTCT
CACGGTCTTCAAGTATCGCTTGTTCTGGCAGTCACATCTTGCTACCATGCACCCCGACTGCAACACACTCAGGCGGTGTGGACGTTTTCCTCTGTGGATA
ACCACTCAACTCGCCATGTTCGTTTTGTCCAAGCACCGATGTTCGCTGTTAGCGAATTGGTGTCGTCCCATTTCGGCGCATACGTGAGTGATCGATTGGA
GTTTGCTGCTCACAGACACCATCAGTGGGCAGAGGGTAATCAGCTGTGCTGGTCCCCACGCCTTACGACCCTTACACCCACGGCAACAGGCATAGTTGTG
ACAACGTCCCAAGTACTGCATAGTGCCAGCACGAGCAACCAAGGTGCCGAAGCGTATCAAGTGAGTATTTCGTACCAGAACGCCAAAGTGGAAACCCAGC
AACTAACAGAAGACCACCACCACGCTGACGTGGAGAAGTCGGCAAGGAAGATATCGAGCTTGCCTCGTATGCAACCGCTCAACGTCAATCCTCGCTATAT
GGACTATGAATGTTCAGCATCCTATTGCAGGAGACGCCGAACAAACGCAGAGCGTCGGTGTGCCTTCGAGTCTTCTTCTCCCGCTTGCAAGAAAGGCAGT
GGCCTGATATCGACTGCTAGTCCCATCGGCAGCTGGGAGCAGATGCGATCCCGTATCAAGCTGGCGAGCTCGCGTTTATTCGCGTTCGAAATGGACCCAG
CCTGGCAAGACCGATGCAAGCACAGCAAAGCTCGTCGTGCCAAGTTACAGTCAGCATCGTAACGTCACTACCAGACCAAACCTCCACTGAGACGCTTGAG
TTATCGGTGAGAGCTATGCAAGCGTATTTATTTGTCGAGCTAGTTGTCAGAAGAACCATAGCTTTTATCAAGTGATCAGAACGAAGCAACTGTTTTCCCA
GTCAAGCTGAATGACCAAAAACTTTGTCGAT