Description :
Non Conding Region
Location :
Scaffold_1:98595- 99257
Sequence
662 bases(100 bases per row)
TTGGTTCTGCCCCTCCTCTCTGTGCTTCGGCTCCGCTCTGCTGCTTCCTGCTACGAAAGGAAAATGACTGCGAAGCTGCGGGGGGCCAAAGGGGGGAGAA
AGCTCGCGCGATCCCCCCGAACCCGCAACCGCGTCTCTGCGCGACTGTATGCCGGTTGCCCGAACAGGGCCTTCTGGAAGTTTTTCTCCGTTTTGCCCAG
AACGGACCTGGGTGGGTCGAAGCTCTCGTACTTAGCGCGGAGCGGCCTCAACGCCTGATCCACCGCGCCGGATTGGCCAAAACGAGCGGCGAAAGGACGG
GACATTGGCTGAAAATAGATTGCAGAGGGGCTGACCAGCCTCCGCGCGGCGCTGCCAGACGTACTTACACTACGCGTGGTGCCGCCTGAGGGCCCACCTC
AGCGCTGCAGCAGACTACTATATGTATTGTCGGCAAGCAGAATGGCCTTGCTGCTAGTTTATCACTTTGAGTCGGCTCGTCGTCGTGCCATGAGAGTGGG
TAGGATATCAATCCACGCAGGCTCGCTGCATTGGCGGCTGGGTCGGTTCGCTGAATGCAGGCGGTATAGAGGATCACAGGCAGCAGACGACGCATGGACG
TCCACCGTCGTCCACAGCAATCAACTGCTCTCCGGCCATTGCACTCCGCCATTTACACTTCC