Description :
Non Conding Region
Location :
Scaffold_1:98498- 99504
Sequence
1006 bases(100 bases per row)
ACAATGAAATCTATTCCCACTGACAGCGAATCATTGGCGGCAAGTCTCTGTCTCAAATCTAGGGCGTTGATAGCGAGCCGAGTAATCATCCATAGATCCG
AGTGTTCAAGTTTGATTGCGGTCAGAATTGATAACAAACTTCTGTATATCCTTGTCCTGCTGCGTACAAACCACTTGCCATTACCCTCAAAGCGGACTCC
ATCAATTGCAAATAGAGTAGTGACCTCCCACATGAGCTAGAGGTACCCTACGATTCCTTTGAAAGACGGCATACTCACACACGCCGTTTTCTGCGAATTA
CTTTGCATAAGCATTGTTTTGATGAGTCGTTCACATTCGGTTCATATGACATTCGATTCATATTACATGTAAGAATGAAGAGGTTCCTCCGTTTAAATGT
GTAATTCCTAGTCTGGGAGTACTGCAATGAAGGTACCCGTGAAGCATTCAGAGTTTAGAAAAAGAAGGGAGGCAAATTCACGTTACGATTTGAAGATTTA
GAGGACGAGATATAAATAGACAACTGCAAGTCCACCTATATTCATCGTTCCAGACTCACGTTGTTTCACTGCCACAGTCACCATTGTGAACCAGTCTATG
CAAAGCTTGCTTCATTTCATTTATTTCCCAATTCGCTTTGGATAGGCTTTCTTCAAGCGATTCTAAAGCTTCATTGATGGACAATAGATCAGATTTTGGC
GTCGAAAACTCCCCGTCAGCATGATTCTCCATAGATGTCCGTCTTGCCACTTTTTTATCGCTTGAAACTGGTGACATTGCTTGGCGAGGTCTATGTGAAA
TCATAGCTGCATCAGGTGTGGCCAGATAAAACAACGGAATCTGCTCTCAAGCACTCGATCAATGGGGACTGAAATTCGAAGTGAACAAGTCTTTTGCAGG
TCTATAGTGTAACGAACGCTGTCGAAATCGAAAGCATTCATCAAAATTTTTCAAATCCAACGGCCATATGATGTACTTGTATTCCTGTATACGTAAAGAT
GGGCGT