Description :
Non Conding Region
Location :
Scaffold_1:98465- 98695
Sequence
230 bases(100 bases per row)
TCATCAAGGTCGCTCGGTTGAGATGCACGAGCCTTACGACGACAGCTTCCCTCATCATTAGAACCCAATCGTAATTTATTGCAACGAAGGATGAGTCGGT
TGACTAGAATGAATATATACAGCGCTCCCATGAACAACAGCACTTCTTGCATGTCATCGACGTACATATTTCAGGTTCGAGATCGATTGTTGCCTTTTTT
GTCAGGCATTTTTTGTAATTTTGAAAAAGA