Description :
Non Conding Region
Location :
contig_1:98370- 100392
Sequence
2022 bases(100 bases per row)
GCGAGCAAATGGGTCTTGGGGAGCACTGCAAGTTTGGAAGTTTGGAAGTTTGGAAATGGCTACGTCGGGACTGGTTGATGCGCACTTTGGCCAGTCAAAG
TTAAAGAAATGCGGAAAGAAAATGTAAGGAGCGACCTTTAGTTAATGTATCGTGCCCTCAGCCAATGAGAGCGCTGCAACATAATAGTGTGTGGCTACCA
GCCCGCACTAAATACGGTCAAGTTGAAGCAGTCGCGCTTCTCCACTGTAGGCACCGCCGATTTCGGCTAGATCCTGCTGTGTTCCCTGAAATACTCTTTA
TGGGAATTGCCAGTCTCTACCGACTTGGCAACACTGACATGAAGCTGGTGTTGGGTATTCTGCTATTTTGCGGTGGCTTCAACCCTACGACGTAGCCGAT
CAAAAACCTTGCACGCCAAGTTTCATGAAGGTCAACAGCGAGCTGCAGTTGGAGAGTGCACAGTACTCGAACACCTACGCCCTCAGCGGTGCTTGCAGCA
ACCCCGCGCCGAAGCACATGCCTTTCGCCAGCCAGCAGGCTCTCGCGCGTGGTCCGCAAGACTCAGTCCAACGTATGAGGACTAGATCCTCTCTTCAGTC
CACATTACCATGGCATCTTCGTGAAAAAAAAACTCCAACGCAGGTACCAGCCACAGGTTGAGGTCAACTAGTGGTCTCCAGACCAGTAACGCTGGACTTA
CAAATAAGATCGGGTCGCGGTGGCCGCATTGCTTGTCACGCCAATGCCGCCCTCCTTCGCATCGGTTCATTCCTCATTTTTCTTCGGGCCCAGCAAACTT
TACCACAGTAAGCCCACTTCTACTCCCCACCGGCATGGCGCCGAGATTGCGACCATGTGCAGAGCGCTCTGCGCCGTCACCCCTACCTATCTACTAGCGA
GGTCGCGTGCTTCACAGTAAGATTCACCCTTTCTCGACCTGAATTCTGTAACTTGTCTTACTCAATCGTTCGTGGACAGATTCCCACTTCCGCCACCTCC
GAGCTTGATGAAGAAGATTCCGCAGACGACGATGAGTGGGGCATCTTGCACGCCCCGACCCAGACGTGCCGTGTGAAATTCGTCACCGAGTCTCACGGTC
TTCAAGTATCGCTTGTTCTGGCAGTCACATCTTGCTACCATGCACCCCGACTGCAACACACTCAGGCGGTGTGGACGTTTCCTCCTGTGGATAACCACTC
AACTCGCCATGTTCGTTTTGTCCAAGCACCGATGTCGCTGTTAGCGAATTGGTGTCGTCCCATTTCGGCGCATACGTGAGTGATCGATTGGAGTTTGCTG
CTCACAGACACCATCAGTGGGCAGAGGGTAATCAGCTGTGCTGGTCCCCACGCCTTACGACCCTTACACCCACGGCAACAGGCATAGTTGTGACAACGTC
CCAAGTACTGCATAGTGCCAGCACGAGCAACCAAGGTGCCGAAGCGTATCAAGTGAGTATTTCGTACCAGAACGCCAAAGTGGAAACCCAGCAACTAACA
GAAGACCACCACCACGCTGACGTGGAGAAGTCGGCAAGGAAGATATCGAGCTTGCCTCGTATGCAACCGCTCAACGTCAATCCTCGCTATATGGACTATG
AATGTTCAGCATCCTATTGCAGGAGACGCCGAACAAACGCAGAGCGTCGGTGTGCCTTCGAGTCTTCTTCTCCCGCTTGCAAGAAAGGCAGTGGCCTGAT
ATCGACTGCTAGTCCCATCGGCAGCTGGGAGCAGATGCGATCCCGTATCAAGCTGGCGAGCTCGCGTTTATTCGCGTTCGAAATGGACCCAGCCTGGCAA
GACCGATGCAAGCACAGCAAAGCTCGTCGTGCCAAGTTACAGTCAGCATCGTAACGTCACTACCAGACCAAACCTCCACTGAGACGCTTGAGTTATCGGT
GAGAGCTATGCAAGCGTATTTATTTGTCGAGCTAGTGTCAGAAGAACCATAGCTTTTATCAAGTGATCAGAACGAAGCAACTGTTTTCCCAGTCAAGCTG
AATGACCAAAAACTTTGTCGAT