Description :
Non Conding Region
Location :
Scaffold_1:98274- 100053
Sequence
1779 bases(100 bases per row)
TGGTCGCTTATTGATGGTTGTTGGGAAGTTCTCAATGATTTTGGAAATGATTAGTCTTTTCTGAATGTAGTGAGTGCTTCGCGAACGATTACAGCCAAAG
GAATGCATCCAATCACAGATTATCTGCTCGTCGTTGCTAAATGAATGGACTTCATGTATTTGATTCAATGGTTGTCCAGCTATATGATTTTATACAAGAA
CATATTACACATATAGGATTATAAAGGACTATCAACCAAAGTAAAAATCTCCCGTCAAGAGGTCTAATGTATCGTCGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGACGTTATTAAGCTCCATGGA
TCAAAGACGAAGTACTGAGTACCTTGCTGGAGCTGAATATAGAATATTTCACAATTTTTGTTCATGTGTCCTATACTTTTTTCCACTTTCTCAAATCCGG
TTAGCATGAAACATTGGATTTCTCTTCATGTATTGCGCGGATCGAAGTGCGATAATCATTGTTCTCTCTCTTTACACGTGATGGATCTGTGATGTGATCG
CCATGACATTCTATGGCATCTTGAATGTGTGGTTCCGAAATATTGAATTGTCCTATACTTATTTCCACCACTGTACAATGGACGATGGAACGATTATCAC
TCCCGTCGAGTTCAGCGCTCGATGCACGTGAGATTTACCCATAGAGGAGGTGGCGACTTCTGCCTTGTCAGTGAAGAACCCATGGCCTTCTTACACAAAC
GCGGTTTGGGCATGGCAGCAGTCGTGACGTGAGCGGCGTGGCTTTACACACACAAATCTAGACGCTTGCATACAGTCGCATGACTCAGCATTGCGAAGCT
TTGCGCACGACATTCATCCTGGCATCGGACAATACCAACTACCACGTCGTGAACCCTGCTTCCTGTGTGGAGGTGCGCTGCGAGCACAAGGCGACTTCAT
TGACCGAGTTCCTGGCGTTGGATAAGGCTCGTGCATTCCAAGCAACCGATGCAACGTTCGCGCGCTTCACGCTATAGGTCATGAAACGCCAAAGCATCTC
GACGACACCCGGGGCGACGGCGGTTCTCTCACACTCACATGCTCCGTGCCATTGTCACGCGTCGCGCAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGCCAACCGCGACCTCCCCGTG
GATGGCATTGAGGAGTACGCTCTTCGACCTCTCGTTTGACCGGCACTAACATGTTTGCATAGGATGCTGGGGTGCGTGA