Description :
Non Conding Region
Location :
Scaffold_1:98229- 98672
Sequence
443 bases(100 bases per row)
CATATACGCTTAGAGCAGTCCGACAAACCCCCAAGGCGGCTGCCGATGAAGAACACCTGCAGGGTGAACGGGGGGTCGTGTTCGTCGTTTGCATGAAACT
AACGGACTTCCGTGCACATTGAGCGAATAAGAGCATTGGCTGTGTCTAGATCTCCTGGCAGGATCGAAGTTCCAATGACACTGCTGAGTGGATATTTCGA
CCTGAAAGAAGGATCGGGAATCGCTGGTTATCGCAGTTGAAGGAACTTCGCAATTGTTTCCTGTATCTTCAGGTTAGCTTAGTTTTCTGTTTGTTGCACG
GTTGGATGAAGATCATTGCAAAGAAAATCAATTTAGGTTTTGTCTGTCCGCTTTCTTTTTGATTCCTGAGCGAAGGCGACAGGTAAGGAATGAACAGACA
TAATAAATTAGGTTTTGAATAATGTGCACACATCGCAGACGCT