Description :
Non Conding Region
Location :
Scaffold_1:97862- 97927
Sequence
65 bases(100 bases per row)
TCTATTCGTCGAAATGTGTCGAAAACTCGATCCACAGTCCAAAAATCAACGTAGCACTGCACGTC