Description :
Non Conding Region
Location :
Scaffold_1:97747- 98364
Sequence
617 bases(100 bases per row)
GCGCTCTGCGGTTGGTGGTGGGCTTTTCGATGTGTATGTGGGTGGAACTGTGTGTATGGTGCGTATGAAGATGGCTTGTGTATAAGAAGAAAAGGAAGAC
AGCGAAGCAAAGAGCAGACGCAGACGAGCAATGCGCCTTGTACGAATAGGAAGAAGACGGCGAGAGAAGCAGAGAGGAGAGATGGAGAAAACGACGGAGA
TACACACCGAATGAGAGAAACGAAAGAGAGGAGGAGGAAGCATGGTTAGGAATAGCAGACGCAAGTAGTAATTTAAAAAATGGCGTACGACGCAAAAGCA
CGCTTGGAAAGAAGGAGCAACAGCAGCATTTGTGCAAGTGAGCTCATGGCGCAAGTGAGACCATGGCACTGGATCTAGTCCCTTCGCGTTCTCAGCAGCA
TCGCTTGTCTTCATGCAACCAACAAGACAAAAACATGGGGGGGGGAAATATATCAATGTTCATTTATCCAGAGCAAAATGAAAAAGAGCGCAGCTAACTA
TACAGCAGCAGCAGCGAGTCTGCCACAGATCTAGTTTTTTTCTTTGTTGTTGTTCTTAAACTAAAGAGCTTTTCGCTCTTTTCTTTGAGGGGTACACACG
CGAAAATGGTTGACATT