Description :
Non Conding Region
Location :
scaffold_1:97743- 97852
Sequence
109 bases(100 bases per row)
GAAGCTCGACCCACCGTACAAGACGTCAGATCCAATGTCAAATGCAAAAACTAACTGTATTATTCCTACACGCCAGCAAGACGCGATCCGCTGCCTTCCA
GCAAGAGAT