Description :
Non Conding Region
Location :
Scaffold_1:97517- 98151
Sequence
634 bases(100 bases per row)
ATGGCCTGCCGAATTTGCGACAAAAATCGCAGAACGTCAATGGTGTGGTGCACACCAACAAATGCCCAGAAAAGCGCGAGCCTGGCAGAATGCCAACGAC
CGCGGGAAGGAGGCGCTCTTGGCCGTCCTGTGTGTGTCTGCGGGGGCTTCAAGACATCAAAGCCTAGCCAGCAGTAGCTTGAAGCATAGCAGATGGAGGA
TCGACCACGGGTATGGACCCAGTTTCTCATGATCAAGCGGAAAACCGCAAGATAATCCAGCAGGTGATCAAGATGAGTCGGAGACAATGATTCAGCGTGA
AGAAGACCACGCGTCGCACCGAAGAAGAAACAAGCAGGCAGCATCAACACGAGGGGGAGGCTTGCCTTTTACAAGACACAACACATAAGGGTAGACACGA
TCACAGCAGTAGATCCAACACAGCTTCCACACCCTGACTCAGCACGAAAAACAAACCAAACTGAAATTATCTGCTAGCTTGCACTTCCCTGCTGCTTACC
GACTGTCCTCATTCTTCGAGTCATCCGGCGCACGCCCAGCAACCGCGTCCCCCCGCCGGACTAGGACTGGAGCGGCGCCGGCTGCGGCCGCGCGGACTGG
ACTCGGACGAAGATCTCCTACTCCTAGCGTGCTC