Description :
Non Conding Region
Location :
scaffold_1:97462- 97784
Sequence
322 bases(100 bases per row)
GATCCATGCATATCATTCACTTCAACTTGAATAGGATTGGTCAAATATAAACTGCATAAGCCAATCCGCGTCATTTCGTATCCATGTTGAACTGCTGCAT
TTCTACCAACTAAATTCAGCGCCAAACTGTACGCACCGCACGCTCAAATATACTGATATTACATCAAGTGAACAGCCATCTTCGACATCAATATCAGAGC
TAAATTTCTCTATATAATGATTAGCAGTTCTTTTGCTGCATTATCATCGCTAATTCAGTGTTTGAAAATTATCCGCTTTCACATCTGCCCATTCCCAATC
TTGACACCAATCAACAAGACGA