Description :
Non Conding Region
Location :
contig_1:97326- 97435
Sequence
109 bases(100 bases per row)
GAAGCTCGACCCACCGTACAAGACGTCAGATCCAATGTCAAATGCAAAAACTAACTGTATTATTCCTACACGCCAGCAAGACGCGATCCGCTGCCTTCCA
GCAAGAGAT