Description :
Non Conding Region
Location :
Scaffold_1:97291- 97834
Sequence
543 bases(100 bases per row)
GAATCGTAGCGTATTTCCCATGGAGATAGCTTCTTCCATATCGACGTTTTCTCGTCGTTGTCGTGTACCTCCTTCGTCGTTTGCAAGTATATAAAGCCTT
GCTCGGCTTCATGCAAAAAATGAAGCTTGTGAAGAAGTGGGTATGCGCGCTGATACGATTCCGCCGATGCAGCAGCGAGTGGTCCCATAACCTCAAGTCG
AGCGTCTTTCAGATTGCGCTGGAAAGACTCAAGCTCACCATTGTGCAAGCTGTGCAGTACACGAATCATTTTGAGCTGAGAGACATCGATACCGCGTAGT
CGTGTCCCAACGCCACTACGTCCTCCAGCTACGCTGCCTCCGTTTGATGGCATGAGCAGCGCGTTCTTCTTTTCTGACGACAATAAATCAGCCAGCAGCT
CCCAACGAGACAGACGCCACGTGCACTCCAACGCGTATGGGAAGAGTGTGCCCATAAATTCCGGCTCTTGTGTGACGATACCGTTGATGTGCTGTAGAGC
ACTTTCAAGGCGACCCAACTGAATCAGGCAGCCGATCATACCA