Description :
Non Conding Region
Location :
Scaffold_1:9714- 11481
Sequence
1767 bases(100 bases per row)
ACCTATAAGATTCTGTGAGGTCTGGTGTATGCTATGAAGATGTGAAAGTGTTATTGTCTTTACCTTTTCCTGACTATACATTCTACATGCTTAACCCACC
AGCCACGTCAATGTGTTCAGAGCACATCCTAAGGTAACCTACGCCTTTCTCACCGAGGGTGGTCGGCCAAAATTTTCTGTTTTGTCAACTCTTTCTAATA
AAAATTACATATGCTATCGCCTTAAAGGTAAAGTATAAGTGACCCACTTTAGCGTCATCCATTTTCATGGCTAGTTCATTCGGCAGGTGAGTTGTTACAC
ACTCCTCAGCGGATCAAGTTTTCGGACTCCTCTATATCATGCGTAGACTTATCGTGAGCCTGCAGACAGCTTTGAAGCTGTGGTTTGATGATCCCTTGAT
TAAAAGAAGAGTATTTCTCTATGGCAGGTTATGTGGTCATTTATCAGTCTATTTCATTGGTGGTACATCGTACTAGGTAAAGCCACTATTGATGATGATT
TACAACTACGAAACGCTGTCACCCGTATCAAGGAAGAATCTGATATGAGCAAGGTTTAATGCAGACTGATTGTTGAAATGGTAAGCATTGCAAGCGGATT
TTCGTCAGACTAATTTTCCTGCATGCAACTTGCGGTTCAAAATCTAGAAGAAGAGAAAGCAAAGCAGCAACTTGAGCTGGAACAGAGAAAGGTGCAAACT
CTGAAGAACGATGGTCTTTACATATCTGATTGAAATGAGCCGTTCATTGTTCAGACAATTCGAGGTGCTTAAGATATCGCCTCAACAATGTAAATTATTT
TATAACCCTTCTTCTGAGATTTTTCCAAGAATGAATAGTTTTGTATCGCTCCTATTTTCCATTTGCATCACGTTTCGTCTGATAAACCCATTTCCAGTGT
GATGTTGAAAAGCGGCTCGTTTTGGTGAGAGGAGGTACCTTTAAACAGCTACAGGCCGTGGCTATTTTCCGTGCCCAAGCAATCATTGAAATGGAGGGCC
CACATTTCGGAAGCCATATTTTTAGACAGCACTTTACGGTGCTTGGGTAAAAGAAGCCGATTTTATCGCCAGTCTTCCCACCAATGCAGCTTGGTCGTCG
TGTTGCACCACCAAACAACAGTGGAAGCTTGTACGGGCTGCCAGCGTTGCGCATAACAGCAATACTTAGTCGTTTCCTTCGGTTCTTGTAGCCTAGCATG
CGCTTTGTTGAGACAGTTTTGTGGGAAGCGTGCAGTAGAAGTGTACCGTATCGTCGATGCTGTAGATGTCATGCTTTGTGTTGAAAAACTAGTTGCCGAC
ATGTAAAGGCATTGCTTATGGACACAATGTCTCGTGCAAACTAGAACATCTTGAAAGATTACTCACGGATTGCTAATGTATGTAATGTCTTTAACATTCG
TTCAAGATGAGCTTGAATTAAGGCTTGCATTAGCTAAACAGTGAGCTAAGGACCTGAACAAAAATAAACACCTTTCATTTTGCCTAAATACCAGAAGTGT
TCAACAGGTTATGAGCCCCAGCTTACGCAAATTCTAAATCCACCAAAAACTTCAAGAATGAGTGATCCGAACGTCCTCTTAAAGGAGTGTAATTATTTTT
CCGGGGAATTCAATACTCGGCTACGATTTATGAAGAAATTTCTCCCCCAACTTTATCAATACAACGAAGAAGCCATGTATTACAGATCAAGTAATGGGAT
TATTATGAGTCAACGATATGAAGTTTTTGCAATCGTCTCAATGTCCGTGAGTGGAACATCTAGTCGA