Description :
Non Conding Region
Location :
Scaffold_1:97111- 98439
Sequence
1328 bases(100 bases per row)
GTTTTGTGTGGAGCGCGTTCATTTTTTCTCGACTGGTTTTCGATCAAGTGCTTCACAACGGAGAAAAGCAAAAGCGACGGATACCAAGCTCTGTTGACAT
TGCGTTTGCGCTTTTTGGTAATAAGAGTGCCGCCAATATCCTAGCCGCTCGAATGAAATCTCAGCAACCGGTGGAACTTGGTGCAGATAGAGATCATCCT
GAATTTGTTCCGTTTAGAGATGGCCTCCCGTTCACATCGAACCTCGTGGCACTTCGGCAAATTATTGACCAGGAGtttgacgatgaaaatgaagctgatA
AGATGGCAAGCATTAGCACTCTTTGGTTGCGAGCATTACGTGCTCTGTCGAGATCGTCCCCAAACGCTGCTCGTACGTTTCACTCCAATATCTGGCAGCA
GCGCCAAATGAATACTCAGCTTGCGTCATTTACACAACCACGCCACGATACTGTGCTTTACGCGAAGCAAAGTAACACGATAAGAGCTACCTGTGAGTAT
GCAGACGGAATGGTGGACCCTTATCCACGTTTCTGGCGAAGAATGCAGGAGCTCGCGAAGCGGATGGAGGGTACAATCAGGGATATCTTGAGTCCGATGA
CCAAATGTTCAAGTACTCACAAGGGTACTTTATCCTCTGACAGCGACTTTCTTGTAAGCAATTCCCAAAGATTCTTTCGCGACTTTGCCGTGACGATGCA
ATCTCTAGAAGACATCGCACTCTGTCAATGTGAACACAAGGCATTGAATGAAGCACAAGTGAACTTTTTGAAAACTGTGATGGAAGAACGCTTCGGGAGT
GGTGGATCGAGGTACTGCGGATGGTATCCAAGCTTGTTTTATGAGAGTCGAGAGGACTCTGGCAAGCGAGACGTGATCGTAGTGGATGTCCACACAGATT
CGCCTTGTGCTGTGCACGATAACTGCGGAGGCATTCTACATCTCGGAGTGGGTGATCCTTTGATGGGCTTTTTCGTCGTAGATAAAGTCATGTATGCCGG
TCCGGTGTTCAGCAACTACGAATTCGTGACACCGATAAACGAGCGTTTGACAGATGAAGAATTTACTAAGAAGCTACCAGCAATAAGCCAGCCGCAATGG
GCTCATCAGTCTTATCTCTGTTAGGTGACGATGCAGTGGTATTCTAATGAGTGTATCGCGAATGGTGGAGTGCTAGTTGGAGACCGTGGCGAAGATATCG
GCAGTTAGCATCAAAGGCCAAGCCTTGCTGGAAGGCCCGACTTGCATCAGCGAAGCGCCCGAGACAGCACAGCGCATAGCCTTTGCGATAGTACCCCTac
aaaagaagaaaatcTGTCAGTAACACGC