Description :
Non Conding Region
Location :
scaffold_1:96660- 97006
Sequence
346 bases(100 bases per row)
CTCATATCCTTGAGTTCATTCTACCCGCCAAAAATTTAGGTGGTAGATTGGAATGTTCTAGAATATTTTCAAGATCATAAAGCCATAATCTTCCAGCCTC
GTAAACATTCAATGTTTTTATGTTAAAATCACACCTTTTTCATCGGAATCATGTCTGCAAACGACTCCAGTCGAATTGCATTGTCACACAGCTGGTAACA
AAAGGCGACTGctcaaaaaaaatgttttgtttATTTAGCGTTAGGGGTTTGACCAATTCGAGCCCCACTTATCCATATTATTAATGTGGGCCTATAAACA
AATATTACATGTAGTTCGATGAGCACTTTAGCAAGGAGCGCGCGGT