Description :
Non Conding Region
Location :
Scaffold_1:96652- 102715
Sequence
6063 bases(100 bases per row)
GTGCCACCTGGGCCAGGTAATTCATCGTTAGCGCCACGCGCTTGATTATCTTGTGCTTGCAGTTTGGGCCGGGTTCGCTTCCCCACGCTGCACGCACAAG
CTTGTAGATGCGGAGGAACGATGCTTGGTCGCACCGTAGCTTCTTGTAGAACCAATCGATCCCGGTGTACGCAGCGCGTTCTCGAACATACGAGTGGCAA
ATGTCTTGGTGGGACCAGGTCGCTGCCGGAAGCCGCGCTTGTCTGCAGCAGCGACGACCGCGCCGACGCAGGCTCCTATTACAGCAGCGAGAATAGCAGC
AGTGGTGTCGTCCATAGCACAAATGTTCTGGACCAGCACGCCTCGAGGAGCTGTTCCCAGAACAGGTGGTTCGGAACGCGAACTCCGCAAATCGGTACAA
TGTACTACTAATATTCTAACTAATAAGAAGACGTTTAATGTTTGAGGACAGAACGTGTTCCCTACTTGGACAAGGGCCTTAGTACCCTATTGGTGGCCCC
TGAGGTTCTTGGTGTGCGAAGTGTGGTAGGGGCAACGATAACTCGATAATTGTAATTATGTTTGCGCTTATATTCGACTGTACTGCTTCGTTGTCTGCAT
GCGCATAACAGTTATCTACGCTTGCAGATCTTCGTCGTCGTGCAGACGCTTCGTAAATTATGGGCTTACATGTAGTCTGCTTTTCGCTACTTACTGACCA
ACCAGTACGTCTTGCGTGTAGCCAGGGGCAGGATTGCGAATTGCGGGAGTCTGGGGCAGACACTGGTGGTGCTCGATCTTCGCGTAAAGATCGCCTAAGC
GATAAAGCGCTCGTAAGTGCTTGAGGAGCGTGTGGCATGAGGCTGGTCAAACGAAAGCTTAAAACCTTTTTATATACCTTAACCCCCCCCCCCCCGCGTG
CCCACACGTTGTATATGACTACCTGTTATGAAAAAGAGCAGCATGTCATTTTCTACGTGAAATGCACAGGTGTAGGTGAAAATATGTACAAAGAACGAGT
GGAAATTACAGAGAATGGTGAGTTAGACTGATTATTTGATTGGTAGTAGATTGCTAACAGGAAAGGATCTCCCCATCATGCGTATGAGACAGTGCCACAA
CTATGCCCTGGTTACTCCGATCAGATCAGACAGGATATGATACATGATTGTACACAGTGGCTCGAAATGTAGAATTAATGTCACCCGATATAACAGGATA
TGTAAAAGAAGAGGTAAGCTGGAAAGAAAGAACACTGTAGACACTATATATTGATCTGTAGGGTTATATTGCGCTTGCGGGTACCAATAAGCACCCCGTC
AGAGAGAATACAGCCTGGGGAAGCGACCCAGTCCAATAAAACCGAGCAGGACGGGCGCTATTATAATATTGAGATGCCGTTAGCCCGCGGTTGAGAGGAC
GTGTCACTTGATTGCTAGCTAGGTACAGCAGGTTTTTGTTTTCAAGGCATGTACAGACTGGTATGTTGGGATGCAATCATAGAATACTTCCAGCATAAAC
CCGCCCTTGTGTTTGATTTTTGTTCACCCCCAATAAAAGGACACAAGCTGTAGTATATACACCCTGTTGAAATTTAGCTACCCATCCGAGGGCGCCTTAG
ACAACATGTGCGTCTGTCTGTGTTAACCAGTTTCCCGCCGGTTATAGGAATGTGTCGTACTTACGGAAGGCAATAGTTAGATCAAGTACGCATACTTGTA
ACATGTAGTATACAGCATTAACATGGTGTATATTGATCAAAGCCAGGAACCGAAAACCCCCGCAAAATATATTGGGGTTTGTATGGCGAAGCATCCCCCT
TCGAGCTTGTGGTGAAAAACGTACACACCATGGTGCAAAACTTACACATTTTGGATCGTCCTGTAACGCATTGCGGGTTTTCTGCAAAGGGGGATGCTTC
GCCATACAAACACCAATATTTTTTGCTGTGCTAAACTGGCCGGCGCTCGTTAAAGCATCCTGATTTTTCCTTGATGCAAGTAGCTCGCTTACAAAACACT
AGAACCACAATAAGCCTTCTAACCGTGAGGGGATGAAACCTACACTACCGATGTTAACGCTAGGTTTAGAAGTCTAGCAGGTGATGGCTGGCTTGTATTT
CATGATGCCAAGCAACTCGCGGCTACAGACCTGCTGCGGCATGCTCGTATCCTGCCTGCCACTATGCGGCCTTTTCTCACGCCGCTTCGAGTAATGTAAC
GGGGTTACACGCACAAGTGGCTACAGCCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAAGGTACAC
CAATGGCTACATACATTTGGAACCACCACGACGGGTGGTTCATACACATTTAGGATTCCTATTGGCTGAAAGCAGCATCTTTTAGCCAATGAGCGACTTG
CATGTTAGCGGAATCCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGGGGAAGTCAAACCATAAATCACAAATAACAGTTTTCA
TCTTTACCAAAACACGTCTTTATCTTATTTAAAGTATACTCGTTGATCTCGAGTATACTTAACTCAAGTAAAAGAAACCTACGCTTCCTCGTACACGTGC
GCACACGTGTACAAGGTAGCAAGGTAGGCCCATTACAAGTAAGGTATCGTACAGATTGTTTGCTCTTGCAACTGTAGTCGCACCTGCAGGCGTGAGCGAT
CGCCCAGAGGTCGCTTGGCGTCGGGATTTTTGCCTTCGACGCCGTGACTGCTAGCTTCGTCGCTATTAGTAGCCGCGTCGCTGTTTTTCATCGCTTCGAG
CCGCTATTACTCATTACGTCACTGCTGCGGGCCGCGTCGACGCCTCTAGCCAAACCCGAGGTGTTGCCGCCGGATGCAGCCTACCCAGCCAAACGCACCG
CACCTCATCAGTAGTTCACGATTTGTTTGGCATAGTGGCGTCTAGTTTAGTTGCAGCGTGCAATCAGATCTCGGGCTGAAGTGCTTGTTGGTGCAGTTGC
CATACTACATGCACACTTTGGGGCAGCGATCTGTGTGAGTCGGTCGGCGCGAGTGCTCCCCTGGAGAGCCTGTCCATTTAATACAGGGAAAATCCGGTTT
GGGGCCCGTTATCTAAGTGATTTGTTCAATTGGGCGTTATATTGGCCATTAAAGGTGGTATTAGCCCCGTTGAGAAGCCTGTTGGGATACTTACATGTTC
CATAGTCAGCAAAAGCTTTGTCGACTCAAAAACGGAAGTTAAGTTAAGCCCAATGACTGCTTCTCTAGTACGAATGAAAGATGCTTCGTGTGCCGCTAAG
TTTGCGCTCTACTAACCCAAACAGGTGTCGAATAGCTACCCAAAATAACCTGGCAGTAGAACCCATAGCCGATGACTGCTTCTGTCCTCTAAAGCATCTT
TAATGCTCAATAAACGCCCATTTTAACAAAGCCGTTAGATAACGGACCCCAAACCGAATTATTTTTAAATTGCGGACCCAAAACGGATTTCCCCTTTAAT
CAATCACCCTTCAACACCATTTCGACCAATCGGCATTGATCTGAAATCTGCAACCAAACCTGCTCCCCCTGGCATGGTAGGCAAAAGAAGCTGCATGCAG
GCTTGACTGATCTCTTCTGATTCGCTCGTTTTTCCTGGAACCTGAAAAACTACCAACCGTGAGAACCCCTGATGTTGCGATAAGCTGGTCGCGCACCTTA
GAGTGAGTAAGAAAGACATGAGTAGTACTCATATGGGATGTCTGCTTGCTTGTCAAACTGACATCGGGCACCCGAAACCATCCAGCCGGCCCCTTCACGA
ACATCGGATACCAGTAGCCGAGCTCCAGATGTACCGCCAGCTGTATAAAATGCTCACACCAACTTCGGATAGCTCAAACCAGGTTACACTACCCGACCAG
AAACTCAATCGGGTACAGACAACGACGAGCGGTAACCCTTAAGTCCGGCAGACAAAGTCGTGGAATGCACAACAAGAACCTCACCAGCCAATCAGATTTG
ACCAGTAGGCTTCACCTGGGTATATCATATGATTTTATGTACTTTATATGACATTCTAAGTGTGTTTTATAATAGATTTAGTGTATTCAAAGTGTTTTTA
CAGTTGTGACGGACGGGGATTTATCTGAATTTTTATGTGGAGGATGACATTCAACGGTGCTGACTATTTTCGCCATTGTTTATACCTGATGCGACATTTG
ATGAATACACGTGTGTTGATAAAGTAAGTAATGACATAATGAGTAAATGAAGTGAGTAGTTCTAACTCACTAGCATTCTAAATGGTGTCAGCACAAGACG
TGCGATAATTACATTGAATTATCGACGTTAGTGCGCCTTACACCCAATAAATATATTATTTACACTCTCCCAATATGGTCCACACCCGTAACGCTAGTAG
TGGGTGAGCACCAGAGGTCGCAAAAGCTGAAAAGCGGTTGTCCAGCCGTACCGAACTTGAGACAGGATATCACTAATACAATCATTTCAGCACATTTGGC
TTGAGTTTAGTAAAGTCAGGGGTGGTCGGAAGTTTGGGCCACTTGGTCAAAGTGGTTTATTGTAGTACAAAACGCAAAACCCAGGATGTTAACACAGACA
CCCTACTACTCTATACAACACAAAGGACATATCAGAAGCGCATTGCGAGTACTTAACACAGGCTGACTGGGAAAGGGTTACCGCACATGGCCTGTTTTCG
GGACACTGTCGAATTTGAGGATTTCAAATATTTCGCTAATGAACGCAGAGCTTAACCCATCTTACAGTACACTTCGTGATATTTGAAATGAAGGTGGTGC
GGTACTTTGGATCGTCCTAGGGCACTAGCTATCTAAGGTAGGGCGCTTGCATTTGTGCGGTTGCGAGGCAAGGTGGCCTCAGCTTTAGAGAATGCAAATC
AGACAATCAGACGATATCATCTGATAGTGCGCAATTGGAGCGATGTGATTGGCGGATCAGGTTGCGATGTGACAACAGCAAGAGGATCAAGTTGCTTTTC
AACAACTTCCGCGCTTAGAAGCCATTTTCATCGGCTCATATCTAGCTACTACATGGCAGTTCCACAGTAGATTGATGTGTTAAGTAAGATCGCATTCTAT
TCCATAATGACATGTTTTTAGATTTGCTTTATGCTACATAGCTTTTATAAAAAGCTAGGGACCAAATAGGCCCAATGCGCGCAAATCGAGTGAGCGGTTG
GGCGGATACTGGGCAACAGCTGACGCACACACACTAGTATCCGAAGGCAATAACGCTTGTTGTTGTGTATGGGTAGTTACTGTCATGTCGGAACGGCGAA
ATTGCGGCATTAACCGCTTTTGAAGAAGTAAAAAAATGCAAATCCTGAAAATCGGTACCCTTTTCCCAGTCAACCAGTGTTAAAAATTGACGGAGCTACG
GCCAAAAGTGTGGGTGGCCGGATTAATTTGGCCAGGAGTGTACCTTACACATTGTCTGAGGGTAACCGCGATGGATTCGCATTAGGCCTAGTTCTAACCG
CGCGCCATGGTGCCATGCCATGCCATAGGGCTAGGTACCGATTTTGCATGGCACTCTATTTCCGAATGAAATGGCCTGCGCCATGGTAAGATGAACTACA
AACACAGTTTAGCACCGTCGGCCAAAAGCGGGTTACATGGGTTCCTAATAGGTGTATGAACTAGTTTATACCAGCAGAGCGAAGTCTGATGCCCGTCGCG
AGCAATTTTCCCATTGTGGCACATGGCACGACCAATTGCCATGGCACCGAAGCGTGCCATGCATAGCACTTTCACGGCACCAGTGACCTAAACTCGAGGA
GCTCTCGGCCAATGAAAAATGACATGGCATGGCATGGCACGGATGGCACGCGGTTAGAACTAGGCCTTAATGTCCCGAGAGCGATGGAAGAATAGGATGG
TCATACTAGTACCCACAACTCGTTTGAAAAAGTTTCGACCTTGATGGGACTCGAACCCACAACCCCCTGATTAGAAGTCAGATGCGCTATCCATTGCGCC
ACAAGGTCATCTGAGTTCCCGCTTTCAGTATTTCAGCTTATATTATTAAATAGTTACTGTTGT