Description :
Non Conding Region
Location :
Scaffold_1:96492- 97767
Sequence
1275 bases(100 bases per row)
TTGATCGTTTGTGGAAGTGGCCGCAAATGGAAAAATGAATGAATGTGCTTTGGGGGATATTGCCTTGGTTACAAAAGTTTGACGCCGCAACGCACTAGCT
GTTCGTAAAACGACTTCCCTTCTcagctcgtcgtcggctAAGCTCGTTGTGCACAATCTGTATGTATACAAAGCGGTATAGTTGTGTCTATGATCAACAG
CCTGGAACGTGGACTCGCAATGATGgttcttggcagcttcaaacTTCGAGGTCGTTGATTCCGGTGCAGAACCCAACCTGCAAGATTGTTCCCTTGGATC
AATGGGGTCAGATGATCTTCGCTTGGTGTACACGACAAACATACTGCAGCACGACAGGGACGATCGATGCACGTTCGTACAGgctaatacatgtatctcC
ACGCGACAGCGAGCGAAGCCGGATCGACTGTCCGAGATAGCGATTACTCGTTGCCTGTACTCAATGAACAAAAAGACGCAAAACTTCAGGATTGGATTTT
TAGATTTGCTAAGCAACCGGTTGCTAGTCGCTCCGTCGCAGTGCCCGTCTCATGCTgcgtactacatgtagtacatgtacatgagTCGATGCCAATGCTC
CAGTGGCAAGGTGAGACCTCGTACTGAGCTCGTAGATAAATCCATACACTGCGTTTCATTCTGTGTATTTTTAATGGTTACCATACTTTCCCAGTCCACA
TCGTTTTCTAATCAACAGGCAGCAACTTCGGGGTGGGCAACTCGGCGGGAAGGTTAGTTTGATTACCTCATTTGCATTTTaccacagcgtcgtccaAGTT
TCAGTACGAATTCAAATGAGACGTGCCCCATTTTGCCAGAAAAGCTCTAACGCGAGGTGAAAAAGACattccagcgccaacaaTGTCCACAGATTAAGCA
CGGGGGGATGTGCAAGCAAAAGTAAACATCGTACAACACCACGTTCATGCATCGCACCAGAGCACAACAATACGCACATGAAAACCCTCACTCGAGTAGA
CAACCTCTGTGGTGGGTGTAGAGCTTGTCGATTTTCGTGCTCACTCTTCCAGTGGTTATCCGATGGTTGCCACATCTACTGTTGTTTGAGAAGGAAGGAA
ATTATTTGATTTACTAATTAGTGGGCAACTTTTCAAATTAAACTGCAATCTCATTTTGCAGTCCTAAAAACTATTGTAGTATAAGCAGTAAATTGTGCAA
ATATTAATACTATTTATTCCTCTATCATAATTTCACTAAACTCTCACTACACGCCACCACTACAATCACTCCACT