Description :
Non Conding Region
Location :
Scaffold_1:96491- 97491
Sequence
1000 bases(100 bases per row)
CTTGATCGTTTGTGGAAGTGGCCGCAAATGGAAAAATGAATGAATGTGCTTTGGGGGATATTGCCTTGGTTACAAAAGTTTGACGCCGCAACGCACTAGC
TGTTCGTAAAACGACTTCCCTTCTcagctcgtcgtcggctAAGCTCGTTGTGCACAATCTGTATGTATACAAAGCGGTATAGTTGTGTCTATGATCAACA
GCCTGGAACGTGGACTCGCAATGATGgttcttggcagcttcaaacTTCGAGGTCGTTGATTCCGGTGCAGAACCCAACCTGCAAGATTGTTCCCTTGGAT
CAATGGGGTCAGATGATCTTCGCTTGGTGTACACGACAAACATACTGCAGCACGACAGGGACGATCGATGCACGTTCGTACAGgctaatacatgtatctc
CACGCGACAGCGAGCGAAGCCGGATCGACTGTCCGAGATAGCGATTACTCGTTGCCTGTACTCAATGAACAAAAAGACGCAAAACTTCAGGATTGGATTT
TTAGATTTGCTAAGCAACCGGTTGCTAGTCGCTCCGTCGCAGTGCCCGTCTCATGCTgcgtactacatgtagtacatgtacatgagTCGATGCCAATGCT
CCAGTGGCAAGGTGAGACCTCGTACTGAGCTCGTAGATAAATCCATACACTGCGTTTCATTCTGTGTATTTTTAATGGTTACCATACTTTCCCAGTCCAC
ATCGTTTTCTAATCAACAGGCAGCAACTTCGGGGTGGGCAACTCGGCGGGAAGGTTAGTTTGATTACCTCATTTGCATTTTaccacagcgtcgtccaAGT
TTCAGTACGAATTCAAATGAGACGTGCCCCATTTTGCCAGAAAAGCTCTAACGCGAGGTGAAAAAGACattccagcgccaacaaTGTCCACAGATTAAGC
ACGGGGGGATGTGCAAGCAAAAGTAAACATCGTACAACACCACGTTCATGCATCGCACCAGAGCACAACAATACGCACATGAAAACCCTCACTCGAGTAG