Description :
Non Conding Region
Location :
Scaffold_1:96372- 98145
Sequence
1773 bases(100 bases per row)
GTGGTGGCTGCGACGTGCGCAGGGGTAGGGCTCGACAGATGAACCCTCGTCTTTGGCAGAAGAAGGCTCCGCGCGCGTTCTCGGTCCGTGGGTCAGCACA
GAGGAGCGATGCCTCTGTCGCGCGTTGTCATGGCTCCCGCAGATTGCATCGGTCAGTGGCCGCTGCTGGTTTTATGCCAAGACGTCGCCTTGTCTCGTCG
ACAGCCGTCGCGATGGACGCTTCGATTTTGCAATTTTTCGTGCGGCCCACGCTATGGGTGATCGAGGTGCGGTCGGACGCGTCTATGGATGCGACTCTCA
TAGCTACGACCAGCGACCGACAACGCTTGAGATCATCGAGTGACGAGTGTTGGGAGTTGGTGGCCGCTCGTTTTCCATCTGTTGTGGGCTCAGGTTGCAG
TGTCCTGTACGGTGATGTAAGGGAAAATGACAGAACTGGGTGTGTTTGGTAAAAGCTGCGTCAAAACAGGAATTTGGAGAAAAAATAACCATTCGCTTAA
GTTCCCGGCAGGGTATTGGGGTTGTTTGGCAAGGTAGTCGCAGGGAAGGGAAGGTGGGGGTGATGTGAGGTGTTGAGGAAGGTTAAAGGATCGTTGTACA
GGTCTTGTTTGCGGTTAAGGAGGCGTAGGAGGAGAGGGGCATGTGAAGACGCCGAGGTGAGCCACCCTGAGCCACTTTGAGCCACTCAATAGTAAAACCA
AGTCTATGTATTTTTATGCAATTTACCCAGGTTTGGGTTGATTTGGGCCCATGTTCACCCAGTTTTGACATTTTCCCGTGATGTAATCATTGCTTGCGAG
GAAGTCCCGATCAAGATGCGCAGTAAAGGCACGCTCCGCGACACCACCAGGGCCGAGTGATATGCCAAGTTCCAACCACGCGTTACCTCAACGAGTTGGC
CGGCGATACCGTAGATAGCGTAGATACCGTAGATAGCGTGGTAAACAGAAGCCACTGCGCCAGCGACGCGCAACGTCAACGTACAGAAAGCTGGTCGACA
CGGCCAGTGTCCCTGCCACGCCAGACAAGCGCCGGCTACCGAGTGCGCTGGCAATCGCATCAGCCTAGACTAGCGGCGTCAGCGACACCTCCTTCGATTG
GCATGTGTAACTCACTGCTCTGGGAGCGTGATGGGTCAACTCAGAGCCATCTCCCTTCGCACACGTTCGCCTCAATAGTCATGGCAGTGGTGCACGAGCC
GCGCCGCATTGCCATCGTCGTCGTCTCTGGCGCAGAGCTACTAGTTGCAACCACTGCTTTCGTCAACACCGTCGGTGGCTCGTCCACCGTCAAAAATTCG
CAACGGCCGAGACATAGAGGGTACAAGCCTGCACTGTATTCGTACAGTACGCCATGGCATCTTGAGCTCTCAGCGTCGGCACGCCTGACGGCGTCATGGC
CGCTATCGTAGCTCCAAGCCACGGCCCTGTTTCTGCATAAAGGTATATACACCAGCTCCCCGGCGTAACGCCGCGCGCCTCGCCTCGTAATGGTGTTCCC
TCCTCCGTCCGGTCGCCAGCCCGTCATCATCCTAATAGCACCACGATCGGCGTGCGTACAGGCGGGACGACAGGCTCGCTGCGTACACACACGTCGACGA
GGTCGTCGCGAAGGCGATGAGATCGTCTGCGCAGAGACTCCATCATCCGCACGAAGCACACTTGCGCTTGCTGTTGGTTCAACGATTCGGTTCGGTGTCG
ACACGTACTGTGTACTCGGGCAGCTGCGCGACCGAGGCAATCGGTTCGAATTCATTTCGACTTTGTCCGTCCA