Description :
Non Conding Region
Location :
Scaffold_1:96339- 96686
Sequence
347 bases(100 bases per row)
GCTACTCCACCACCCAGCCGAGCTTCCTCCGCGATTTAGTATTCTAACTGAAAATTAAGTTTTGTTTGGAAACCTAGCGAGTAGAATATTTTGAGAGATC
TTGAAAGATCTATGgaaagaaggtggcgaactATGCTGCATCGTAGTTATACAGTGCAATTAATTTTTTGCTTTTGACGTGCATACTGATACCAAGTGAC
TTTTCGTCTTCGAAGCGGCACGGCTTTCGGTTGGTGGAAAGCGCCGTTAAAAAAAGCTTCAGGACAGGCTTCAGGTTCAGCTTCAGTTCCTCATTTGCGC
TCTGCCACGCACGCGCGCACCCGCTCAGTTAGTCAAGGAAGATAAAA