Description :
Non Conding Region
Location :
Scaffold_1:96076- 97059
Sequence
983 bases(100 bases per row)
GCTGGCTGGTAATTAACACGGTTACACTGGGTTACGATACGAACACACGTCACCTTGCTCGATCTGAGAATGCTGGAGCAAACACTTGCTTGCTTGCTTT
CTTGGCTTGTTGGTGCACTTGCTTGAGTATGAGCAAGTTGACTTGTGTTATGCTTGTGCTTGTGTGCTTGTGCTTGTGCTTGTGTGCTTGCGCTGGACTT
GTGCTTGCTCGCGCGTCTAGTGCGTGCGCGTGCGTGTGTGTGGCTATATAGAAATGCGAGCGACGGGCAGGAAGGTCGATCGTTCGCGTTCGTCTCTTCT
CTTGTGGTGCGGAGCCGCGTGAATTGAGTTGTGAGCGAGCGTTGCGTGTGCGCAAGTAAGCAAGCGCGCGCTTCTCGTCGCACATCCAACAACATTCCGC
GCGTCATATTCAAACAGGCGGGTTCTCTTCTTTTTGTTTGAGATTTTCTTTCGCACGACCTCCGAAACCTTATATGTCGAGCGGCACGTCTCCATTTGAC
AAAAATCTGCTTGGAAAAAAAAACATTGCGCCGCCGCACCGGGATCAAGTCATCTGTCGTCACAGATCACCATACAAAATTCAAGACACAGTGAGGTTTG
ATGACACCGGAGCCACACATTCAGCAAATTCAGTAAATTTGAATCGACACACTCCATGACCTGGTTTTTAGAAAGATCACACACCATATAAGTCAAATTT
TCCATTAACCTCTTAAATGTTATACCTGTCATATACACTTTCAAAGGTTATCAGCTAAGTGAGACCTTGAAGCACCAACTTGAAGTTGCCCGTCATGCCA
CTTGGCCAGCCACTCACAGGCGCGCAAAACTAAAACCAGCCAATCACCAACACTAACCAGTTGCCCACAGAAAAAGAAGCTTCATGTTGGGCTTGAGCCC
ATTTCAAAGCGCATCACTACTGTATTGAGATTGGGAAGTCTTCGTCATTCATCGTTTGGATCAGTATGAGCTCTGGATCGCAT