Description :
Non Conding Region
Location :
Scaffold_1:96036- 150000
Sequence
53964 bases(100 bases per row)
CGTTGATGTGGATGATAGCGAGTCTGATGCGTCGACGTCCAGAAAGAAGCAATGTACCCGCAGCAAGCTTGGAAAAAGACCGTCAAAGGGGGATAAAATC
GAGCAGGTTCTTTCCTCCCTAGACAAAGGGCGTTCCGGTTCGGATGCATTGGCAGCAGACTGTCGATTATCTCAGCTCTTGGCGACCTATAGCACGCTGC
TACAGTTGCGGGAACGAATGGTTCGTGCATCAACTGGGGTATACACCGAAGAAGAGATCAGCGACGTCGAAAATGATATATCTGTCGTCCGGCAAAAGAA
AAAAGATTTAGTTGATAAGATAAAACATTTACATAAAGAGAGACAAAATTCAGCTCGTACATTCTTTTTGTTTTCTAGTATCATTTCTTTCTTCCGAAAA
ATATCTTGCATTATGGAAGTTAAATTTGCTTGCGGTCTCGATTTACCTGAGGTCTCACAGCACTACAGTCTCTCAGATAGCTTACAAGACAGTCACGCAT
AAAACTGTGGCCTTCTTCCTCGACTATATCGCTTGACATATATTCCATTGAGCTTGCAGCGTCATTTAGTCTGTTTTGACCTGTCCTCAACTGTAACGGC
GTAATTGACTCATCATACACGCAGTAATCTGGATCTTCAGTCATGCGCCTATTAATGACAAAGTGGTGGAGAACCATGGCTGTGCTGATAATAGTAGTAG
TGTTAGCCATGTTACGTTCTATTGGTGACCGGAAAATTCGCCACTTTGTAGTTAGAAGGCCGAAGGCCATTTCAATTCGAATCCTCAGTTGACTCAGATG
AACGTTAAACGCATCAGGGTGATCGTCTTAAATTTGGTTGCGAGTAAAAGGTGTCAGCAAACGTTCGGATACAGGGTAGGCAATATCAGCAATTAAGTAC
ATCTCACATCCAAATGTATTGAGACTTCTGTATGTGTCTGTCTCTTGAAATGCTCGAGAATTATTCGTACTTCCAGGGTAGGTAGCATCAACAGCAGTAA
AACGACAATTTGCATCGCACACTGCTTGAACGTTGATTCCAGCAGGAGTGACCACTAAAGAATTTACTGAAACCCACCGCACCAGCATCTCGCACTGAAG
GCGATTTAATCACACAGAGCCAGCCGTCGACGCAACCAAGACACCCCCTCAGATCATGACCCGAGCTATTCTCTTCAAAGTCCTTACAATCTCCTTCTCA
GAATCTGTATATGGGAATTTAATATGTAGCTCTCGCAGGGAAAGAATGGCGGACATTGTAGTGTCCACGACGCGGTAAAAAGGGCGCAAGTGAATGCCAA
AGTCCGTGCTCATCTGGGTCCACACGACGGCGAGAGTATCTGGTTTCACGGGAACGCCTCAACCGAATGCACAGTAGCAGTGCGAGTCGTGCTTGTGACT
GTTGGCGGACACGAAGAACTGTAGCAACATCATCTGCGGAGGTCGTCTACATGCTTAGTAAGGTCGTAGGTCTTTTTGAAGTTGTGTGCAAGACAACTAA
TTTTAGTAAAAAGAAACTTATTTTATAGATGTCAACCATCCCGCCTTGGTTTGAACTGGCATTATCCACCAAGGCGTCCACTTCTGTATATATCGTTGGC
AACCAACCTCGTGTAGAAAAAGCTCTATCCACTTAGGAAGTCTGTCCACTAGTGAGATTGGCTAACAACGGGCCTAAAAGATAAAATGTGAAGTGAGATT
AGAGTTAGAGTTTCAACGTTGTTCTTAATCGGCAACGCCCGAGACCACAGCCTCGGCTCCAGCGCCTTCGTCCTGCGAGCCACCGGTCCGCCAATGGCTG
CCACTGCTGCATGCCTTCGACCAGTCAATCGTACCGGCTCGTGCCACCGTCCAGCGCCGCTGCTGCGTCCTCCATCGCCGCTCGAAGGCACGCGTTCCTC
ATCGCCCCTGCGTTACTCCAGTACTGCCCGCTTCTGAACCCCACTGGAGGATACCGGTAAGAACCCGGTCCACCAGAGACCGGACAGTTGTCCTGCTGCA
TCGGTGTCTGTCGCCGCGGTGTCGTCTGGTACAAGCGGCGCCATCGCCGCTCAACACAGCCAAACTTGTAACTTGAAAATGAAATCTTAGTCTCGAAAAT
AAAACTTGAAAATGAAACTGAGAAATTAAACTTGAAAATCGGAAACTTGACCCCTGTCTTCGTACACAAGACAGTTACTAAACGCCCCGTCTCACATATT
AATCTTGACGTTGAAGTCGCAGACTTCAGAGTTACAGCATGGCTGTAAGCTCGAGAGCTTCCACAGACTGCATGTATCGTTGAACCAGCTTAGGGACATC
GCGATAGATAGCGGCAAATGGTTCCCACGAGTTTTCCACTTCTTCGAGTCCACGCCATGCCACGTAAAGCTGCCACGCCTTGGCCGTGCTGTCATAGCGG
TGGTTCACAATAGCTCGCATACCGAGCACAATACCTTGGGTTACCACATGTTCGCGAATCTCGGCCGTGGTGCCGAGCTCGGCGTCGCAGTAGTGCTTGA
GGCGTGATCCGTGCACCTTGAACTCGTCATCGGTGAGCATGTGAGCCACAATAAATGAATGTGAGAGGGCACGAACTACTCGGAATGGCCCAACGCAACA
CAGCAGGAGCTTGTTACCAGTCATGCGGTTATCAACGCGTGACCATCACCCTCTTCAAAGTTGCATTCTGTGCCCTTGGTACGCAATATTTTCTGCAAGC
GGCGGTGCTCGTTGCGCTCGACATCATTACAGTGTAACTCATGCAAATGCTCGCGCAGCTTATATAGGTGCGGCGTAGCCGCGAACACGTTAACCGGCAA
CAAGCGATAGGAGTCGCCGGTGGGAACCGACACGGTGTCGAGTAGGAACGGCGCCGGTAAATCGGTAAACAGCTCAATAGGGGCATGTCCACCCAAGGAT
GCCACCGCCGAGTGGTTGAGATTGGCTTGGATCACAGGTAGGAGGTGAAACCAATTGCGGGTGTCCAACTTGAGTTCCATGAGCATCACACGCAATACGT
ACCGGATGTCTCTATTCACACGCTCGACAGTACCGTTGGTCCATCGTGTGTTCACCGGCACCAACCGCTGTGTCGCTTGCAAGCGCTCAGCAAGTTCCTC
CATTACTGCTGCTTTAAAGTGGGATCCATTGTCGGATGTCCATATTTCAGGCAGTCCGAACCGCTTGTGCCAGTCAAGCACAGCCTGCACTGCAGTTCCA
CTATCTGCTACATCGGCAGTGATCAACTCACAGTAATGCGCAAGCTCATCCTTGAGCACGAGTACGTAGCGACTCGCACAGTAGGATCCCCCTAGCTGCA
GGCGGTCCATATGAAGGCACTCGTTGCGCTTCACTGCTGTAGACGTAGGCCCTAACGGACTCAGCACGATCTTCTCGCCTTTGACATGCTTGCAGAGCAA
AGCACTTCCGCAGAAACCGATCAATGATTGGCTTCGCATTTGCAATAGCAAAGCGCTCCGCAAGTGCCGTGTGCATGACGTCGCTGCCTCGGTGTCCTTG
AGGGCCACAATGGGCAACCACTAGTATACGTTGCACCCGCTCGCGGGCTTGCTTAGGGATCCACAGCTTGCCATCGACACGAACAGCTCGATCGTCGCCG
GCAGGTACCGGAACGTCAGCACGGTAGCGGTGCTGCTCACCTCGGACTGCGTCAACCCCTGGTCACGTAAAGTTCTTGTCCTGTAGCGGGCAAAATTCCG
AGTCCGGCTGCGTGCTGGAGTTGTCACCCTCTTGGTTAGTGCTAGCTTACTCACTTACTCTTCCGGAAGGGGGATCTGCCAGTATCCGGTCGCAATGTAA
TCGGTGTCAAACGACCACGCAAAGGCCTTGTTGCAAGGCATCGAGTCTACATCATCGTCTCTCACCGGCAGTGCGACTCACTTGACTGCTTGCGGCGGTT
GCACCGGGGTCGCTCCTTCCTGGCCCCACCGCGACACGAGGACGGCCCACCCATTATCGTCGCCTTTGATGTGCTCTATTTTATAGCGGACGCCAACGAT
GTGCAGGGCCACCGCTGCAGCATCCCGCACAAGTGTGGCCTGACCGTCTTGTCAGGTGAGAAAATTTGGATCAGGTTGGCATGGTCGCAATAGATCTGAG
CACCTTTCTCACGCTCAAGAAGATAAGCAATGTCACTGCATTCACGAACCACTGGATAGGCATCCTCTTCCACAATCGACCAATTCACCTGAGAGCCCGT
GAATAGTTCTCCTTGACGCACCAGTAGCTCGTGTAGTTGCTCAGTGACTGGCAAACCTTTAACCCAGTTGCAAATTTGGCTGAATATGACCGACCAACCG
CCGAGCGAAGCATCGGTGAACATGCAGACAACGGCGTCAGGGTCAGCAAAGTAGAGCTTGGTGGAGGTGACCAACAAGTCGACCACAGCACGAAAGGTTG
ATTCCTCCTCTGGTGGCCATGTTAGCGTGATGCTAGTAAGCTGTGCCTTGTCAATGCTTCCAGGCGCTCTGGTGAGTGCTGAACTCCTTGACCGTCGATA
ACCTTGCCACACCATACAACTCTTGTGTCGAAGAGTACGCACTTCTTCGCGTTCAGCTTCAGTCGTCTAACACCCAGCACCTCCAAAAAGATCCTCAGGC
TAGCGAGGTACTCAGCTGCGGAGCCAGCGAATAGCAGGATGTCGTCAATCCAGACAAGGAGGCTATGATACATCATGGCTTGGAAACAATGCTGCATCTG
TAGCTAGCAGTGCATTGCGGATGTAACGGGGTTACATGGTGTGGAACACACATGGTACGAAGTACCCGGAGAGCTAACAAACGCTCAGTACATAAGTTGG
AGAGTCTCTCAGTACGTTGGCTGAAAGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGATAGTTAAACAGATACATTTACCCCTAGGCGGCTT
GGCCGCAATAATAGTAAATAAAACACTTCTGGGTTTGAAGCATAAAAGTTAAGGTATTAACTTTGAGCCCTGGTCTTGGGCTGTAAGTGTCCTTTGGATA
AGGAACTTAATATAAGTGACTCTTTGAGTCGAACGTCTTCCTCTGACGCTGAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCCC
TCCTGGGTCGATTGACTATATCCTCTGCGAGGATGGAACACCCCGTGTTCGCGAATTTGCCCCCGTCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTT
GCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGCAAGGTCCAGAGGCGGTCACCGCCAGGCTGGAAACGTTCTCCCGCTACGGGAACGCGCTCATGGAG
CACGTCCAAGAGAAAATGAGCGCGGCAACGGCGGCGGCGTCAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGAT
GGAGAGAATCTCCTTCTCGGGACCCGTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGATGGCTATCACCAGGC
TTGGAGGACGCGCTCGCGAATGGGCACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAACTTTCGCGCGTGTT
CGCGCCGCCTAATCAGGTGTACCGTATCCGGTCGAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTATGTCCAAGCGTTGAGAACTCTT
ATCGCCGGAATGGCGGCGGATCCTCTTCCGGAACGGGTCAGCGTGACCGTGTTCATGGAGGGACTTTGTGTGAGCGCAGCTCGAACGGAAGTAGTCCGTG
TCCACCCTAACGCTTTCGAAGAGGCAATGAATGTAGAATTAAATGCCGAGCACAACTTCAGGTCGGTTCGACCTGGTTGGAGCGCTAGTAGCGCAAGCTC
TTCGAGCGGTCCAGAGCCGATGGACCTCAGCTATGCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGAAGCGCGCCGGCATCCGCCGATGCTTTGTG
TGCAATAGCACTAAGCACTTGACGGCATATTGCCCTCTGCGCAAGACGCGCGGGGCTCCGGCAAGCCGACCCTCCGGGTCATCGCCGGGAAACGGCAATT
CCCAGTAGGCGCGGGGCGGCCTACTGGGGAAGGACTGAGTTCTATTGTGCCTCGAAGCGGTAGAGGGCTACGGGGCTCAGCCCCGAAGAGAGCTGGGCTC
TCTTACGAGAAGCGTGTGTGCAAGCCGGGCTTGCTGGTCGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGATTTGGGAGCCTCGCGCAACTACG
CCCGTCGCTCCACCCTAGAAGGGAGTCAGCTGTATGCTGAAGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACATTGGT
AACTGTGTCGAAGGTCTCTGTCGACCTTGGAGTGAAGTTTGAGAGCTTCGATAGCGTGGAACGCTGTTTGGTTTTAGACCTGGATGCGAGGTTAGACCTC
ATCCTTGGCATGGCATGGCCGGAACGCCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTTGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGA
GTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTAGGTCCGAAATTGTTAG
CAACGAGGTTGCTGCTTGCCCTGAGGGCGTACGTGGTGCAGCGCGTTATCCGCTGAGCGGTGCAGGTCAGGTCAATAACCAACAGCTGGGCCCTAGTGAG
GACGAGCGCGGAGTGGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGATGCCCTGCCCCTGCGTGACCCGAGGGTCGTGGTCGACTGCGAGTCGAGGC
ATCATGGGGCGTGGCCCAGAAGATGCAGGTGAAGTGACACCTAGTTCACTGTGGGAAGGCCAAGGACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACA
CTGTATCCTCTTCGAGAAGTGATGCTGCTGCTGCACCCGGTTGGTGGTGACGGAGATGTCGCCCACACCCGCCCTCCATCCCGGCCGGGGCTCGGTCGCG
GAGAGAAGAGGAGAAGAAGACGCAGGGCGTCTGTGACGGCTTCACGTCGGACGGATGTGTCCAGCGTGACGAGCAGTGATGCTCGACGTGGTTGCTGTGA
GCAGCTGTATACACTCGTGAACGGAGTGACGGGGGAGGGAGAAGGCGATATCAGCCTTGACACTCTACCCGCTGCAGAAGCTCTGCTAGGGCTGGACGAG
ATGTCCATTGCCGAGATTGGCGAAGCCTTTAAGGCAGGCGAGCTAGCCGAGGTGGTCCTGCTGGGACCTGAGGAGGAGTTGAACTCATCATCCGTCGTGG
ACGACGTGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCTTCAAAGATTCTTTGGATCCCTTCTACCCGGTGGTGAAGGA
GTATGGAGACGTTGTCTCGAATGACCCACCGACGGGCCTGCCTCCAGATCGAGGCGTGTGTCATGAAATTGACCTGGTTCCTGGAACCAAATACTGCGTA
ACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCATGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGC
ACTCGACACCCACGTTCTGTGGCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCC
GATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGTGGGCTCGACTTGGTCGATGGTTACTACCAATTGCTCATGAGAGCG
AGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGTGAGTGGCTGGTCATGCCCCACGGGCTGTCGAGCGCACCAGAAACGTTCAATC
GTCTTGTGACGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAGACGTACTTTGACGGTATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGT
GGTTAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCACACTAATAAATTGTATGTCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATA
CCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTAAGGGCAGATCCTGCCGAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAAGAC
TTGCGCAAGTGGCTAGGCTTAGCCAATTACTTGCATGAGTACAGCGCGAACTACGCGGAGATAGCTCGGCCATTATCAGATCTCCTTACGAAGGACGCAC
CATGGTGCTGGAACGTCGAGCTCGACAGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGACTCCGATCCTTGCGCTACCGGACCCGGATATTCCGTT
TAGCATCGTCTATGACGCCTCTGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGACGGGCGTGAACGCGTGATTGCGTTTGAGTCTGGCCAG
CTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGACGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGC
CCTTTGTGATCTTTACTGATCATGCGTCGCTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCATTGCCGAGTA
TAACTTCGAGGTGAAGTACAAGCCGGGACGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAATTAGCTCATGTCACGACAGTGACG
TCGTCAGTGCCTGACTTGATACGCAGAGCGTATGCACAGGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTTACA
AAGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATGGTGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGT
CGTTCCTCATTTTAAGTTTCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTATGTCGGGAGAAGACCTATGGCTTGGTGAGCTCGATG
TGCTGGTAGCCCAAGATGTATAAGTGGGTTGGCACCTATGTACGCACGTGTGAGACGTGTCAGCGGACAAAGTCCGCGCCGATCACGGCAGCGCCATTGG
CGAGTTTGCCTGTCCCCAAGGGATGCTGGCAGTCCATGAGTATGGACTTTGTTTTTGGCCTTTCCAAGGATAAGGCGGAAAACACGGGTATAGTGGTCTT
TGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCAGTGCCGGACCCCTTTGATGGTGAAGGTACCGCTTTGCTGCTTTTAGACCGAGTCTTTCGCCAA
CATGGCTTGCCTGAGACAATTGTCTCGGATCGAGACCCGCGCTTCACCGCAAAGTTCTGGACGTTCCTCTTCAGAGTGCTCGGCAATCGTTTGGACATGT
CCACAGCGGACCATCCGCAGACCGATGTTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTG
GAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACGGGCTAAACTCCGTTCTATGTGAACCCTCACGTCCCACTGACG
CCTCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCCGCCCTGTTGCGGTTCGCAAGCAAGGCGATGACTTTGGCT
CTTTGAAACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGAAACATGCAGATGCCAAGGGCAGAAGCAATGTTGA
GAGGTTTGAGGTCGGTGACCAAGTTTTATTAAATGCTAAAAGCCTACCTACTCATGCAGTGTCTGCAGTCTTCAAGACGAAGTTAAGACCTCGGTTCATA
GAACCGTTCAAGGTCGTGGCCAGGAAGGGCTTAGCGTATAAGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTTGGCTTGCTTAAGC
CATATCAAGACCCTGCTCAGGTGAGCGCGGAGGCGTTGGCACCAACGGTGGCTGGGCCACGGACAGCTGCAGGGCAGCATGTGGTAGAGCTACGGGCGGC
TGAACGACAGCAAGTGGTGGATCCACAGATGGCTGATCATCAGAATGTGGCAGAGCCACAGGTCGCGGAGCGAAGTGCTCGAGATGCAGGAGCAAGGCAA
GCTGAACGTTCAGCCGAGCGACTGGACGCTCAAGGTCCGAGACCTGGTTGTGGGTCAACAGTGATGGCTCTAACCTATCCACAAGGTGGATCATCTCTTC
GAGATCGACCGATGGGCGGTGAACGTGAACGTTCGCGTCGTGGACGCCAGCGTCGTATGGACGCAGACGCCGTTCCGGCAAGTGCTGCCTCTCCCCGCGA
GAGCCCAGCTGAGGCAGGTCCTCCTCCTGCTCTGCTCGATGAGCATGGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAGTACGTATGAGCGGTGCTCGCAGCGGGAGCAGGAGGTGGAGAGACTCGTGGTGATAG
GGACATGGTCCCGAAGGAAGCAGGTCCTTCGTGTGTGCTGAACAAGGTTCAGGGACAAGCGTCTCGATAGACGCATAGTTGTTTTGAAACAACTTGCTCG
ATGAGCATGATCCAAATGTGGATGCGCTGTAACAGCGAAAGTGGTGTCCCGGACGGGAATCGAACACTGGCCTTTGGCTTGACAGGCCGGAGCTCTACAT
TGAGCTATAAGGGCTATGCCCGTACGTCAGTCCGAGAGCGGACTACTCATGGTATGAGAGGGCTGCGCCCGGGTAGAGTTGAACCACCGACCTGTGGCTT
TCAAAGCCAACGCTCGACCACTGAGCTGAGAGGGCGTTGCCTTAAGCTTGTCCATTCAAGGACAACAGTTCATGGAACGCGAGGGCTGTGCCCTGGTGGG
TTCGAACCACCGACCTGTGGCTTCCAAAGCCAACGCTCGACCACTGAGCTAAAAGGGTGTTCCCTTAAGCCTGTCCACGCGTGAACAATCGTTCATGGAA
CGAGAGGGCTGTGCCCTGGTGGGTTCGAACCACCGACCTATCGCTTGTGAAGCGAGTGTTCAACCGCTGAGCAGTTGTGGACGACTCGAATGAGTCAAGA
GCATTGCTCTATGCGGTTTGCAACTCTTGGAGTGGGCGAGAAGCGCGAGCGTAGGTCTGAGACCGCTTGAGAGCAAGATGCGCGCTGCGCTTGGAACATT
GGGCCGTGGGCCGACGACGAGAAGTTGGGCATCAACGATGCGTAGGCGTCTGTGAGCTCACGGAGCTGTACAACGCTGGGGTGAGGTGTAGTAACCTCCG
CCGTCTTAACAAGACGTGACCTCGCTGAGGAAAGTTTCGAGAACGGAATGTTCTCATCTTAGTGGGGGAGAGTGTAACGGGGTTACATGGTGTGGAACAC
ACAGGGGTACGAAGTACCCGGAGAGTTAACAAACGCTCAGTACATAAGTTGGAGAGTCTCTCAGTACGTTGGCTGAAAGCCACGCGTTATGCATTTGATT
AGGTTTAACTATGCTAGATAGTTAAACAGATACATTTACCCCTAGGCGGCTTGGCCGCAATAATAGTAAATAAAACACTTCTGGGTTTGAAGCATAAAAG
TTAAGGTATTAACCCCTTCAAACCGGGAGCCTGCATATGCAGCTTTTCAAAAATGCTTAACCTGCATAATGCAGGTTAAGCTTAAATATGACTTAAAGTT
TGTATAGTTACTTTTTTTTAAATCCTCGGCTATACAAAATCTAAGTCAAAAAGAACCCTACAAGTGCAGGCTCTCTGTACGTGTGGTAGCATAGAAGATA
CACATAACAAGCGACGAGACAGATAATATTTCTCTAAATTTGAATATAAGATATAAAAGTTTATGTGTTAAACATGAGTTTTACATTATTTTCCAAAGGT
AAATTTTTTCGCTCCCTCTCCAGCCACTCATTCGAGAATTCGCGCTGGAAAAGAACGGAACCAGGCTCTCTGCATGAAATGGTAGCTGTCCGAGGCAAGT
ACGTGAGCAGTCAAAACATCCCGTTTGGTGTGGCGTGGAAAGAGCTGAAGAAGCAGGGATGGACATCTGTAAGACCGCGAGCGAAGGACTTAAATCCGAG
ATGGAAGTACGTTCGCCGTGGCGGACATGTTAACGGCACAAAAGGCATCGACTTTTTTCTTGGGGAGGAAGAGCTGTTGGATTACTACAGTGGTGGTAAG
CGAGATGGTGGCGATTGCTGGCTACACAGTCTAACCAATTGTTTGTATGATGTTACAGCTTCCAAAAAGCCTTCGTCTACCGGTTCTGGACCATTCCAGA
CGCCACCAGCACCTCCTGCTGATCCTGCTGTCACAACAAGATCACCACCCGCTCAAGCGGCCACCACCCAGCCCACGTCTCCACTTCAACCTTCTTCAGG
TACTCAGCAGCCTTTGACGCGACAAACGCAAGTGAAGCGCACTCGAAAAGTGCCCAAGCTGCCTGCCACGGACAAGCAGAAACGTCGCCGCTCATGTGAG
TACCAGTTGCATATTCATGATATGATATGCAGGATATGCAGGATAATTAACTAGCATTATGCATTAGCTCATGCAGTACACCAGCCCGAAGAAGCCCGTA
CGCTATCCTGAATATTTCATCGACCACATGCATATTGATGCAGTCTAACGCTTGTGAATGCACTATAGTTGACGACGCCATATCTGATGAAGAAAAAGCG
CCAGTGCCAGTAGCTGAACCCGTTACTCAAGTCGTCGCTCAAACCCCCATCGTGTTGCCAGGTCCTCATGGAGGTGACGAAGAAAATGTTGAATCGGGGG
ACGAAGGGTTTTCCAGCGTTGAGTCTGTTGAAGAGAACAACGAAACGGGTATGTCTTACAATGCGATTCAGTGCGTATGCTGCATATTCATGATACCTTA
TACTGATTATTCATGATAACGATTTTTTATGCTTGTGTTACGAAGATATACTTGCAGAAACAACTGACCGGTTGAATGTGGACGCCCCGGGCGGAAGAGA
CCCCAACTATGATGCACTTGAATCTGGCGATGAAGCGGCAAGGGACGACGTTGTCACAGATACCCAGTCTGATTGCAGTGGTTGGGTATCAAATGCCAGT
GCGGCCGGTGGATCGGAGCCGGACCCTGAACGAGACGAGATGGATATTGCGCTGGCAAAAGAATTTCTGGATGGATTTGGAGACACCGACGCTCTGTTGG
CGGGTAACTTGCTGGACAGAACACTGAGAGAGTTTTCGACTAATGGATGGGGCCCAATTCAAGAACCGGATGTGCATGAGGAGTTACAGACGCCTTACGT
TCCTGTTGAAGGCGCTAGTAGCTACCCGGGACTTCACCAAGGCTATTCCGGACCCACTCCTGAAGTACTGCATCGTGGGGACTCGCCTATGGCGTTGTTC
TTTTACTTCATGCCGGTTGCATTGTGGCAGCACGTTGCTGTCTGTTCAAACAAGTACCAAAGCGATATGCTCCACGCTCGTGTTGACGATGCCTACAAGC
GCCACAAGCGACGCTGTCAAGCGAATCCTGTCACGAAGAAGAAGACACGGCGCGATGTGCTACAAGAGCTTCAAGCAGTTCCTCCAATCAAACCACACGA
GCTGTGTCGCTTCGTGGGACTACTGATCGCGCGAACAATTTGCCCAAACCGAGAAAAGCTGGCAAACCACTGGAAACCCACCGACGAGGGGGCGATTCCA
CGTGGAGCGTTTAGTTCTGTGATGGCACGAGATCGATTCATGGATACCTGCAGAAATCTACACTTCAATGATAACGACGACCCAAGAGCGACCACGGATC
GAGCGTGGAAGATCCGCAAGGTTGTACACAATGCCTACCACAAGCACAAGACTTCAAAGCCGTTGACGCACGTTAAATTCATGAAGCGCCTCCACTTGCA
GCTCACCCAGCTCCAAGAAGTGGACATGTTCGACGGAAACACGTTTTGTGAGAGGGAGCAGATCGCCGGTACGTCGGGTTCTGGTGTCGCGGGGCACGCT
TCTACTCATGTAGCATAGTTGGTGGATGAATGGAGGAACCGAGATACGCAGCCGAAGCGGCGTCAGCGTGCGTGTAAAGTTTGCTCTCTGATGCAGGGCG
CGAAGCCCCACACGACAGCGTACTACTGCTCCGAGTGCGATGGTAATGCGCCTATCTACCTGTGTATGCGCCCGAGGCATGTGATTCGCGGGGTCTTGAC
AACCTGCTTTGACGTATGGCACAAGGAATGGAGTGAAGGAAAGCTGCGACCTTCGAACCAAGAACGCCGCATCCGTATGAGCCCAGCAACTCCAACGAAA
GGTGGGGGACCACGCAAAAGACTGAGAGATGCTGCTGATTAAGTATCATGCATATGCAGGATACTAAAGGGTGAATATGCATTTTATCATCAGTATTTGT
GTTTTTGCGAAGTAATGGCTGCAGTGAAAATTGTCTTTCTATATCTCTTGCAGGTTGAAAATAAAGTGCAACCGTCGATTCATTTTGCTTACTATGCAGT
CCGTCAGGCCAGAGCCGGAAGCCCATGCTCAGATTATATTATAGGCTTCATATTTGTATGAGCCAAAAAAACTGAACTTTTGATTGCTCGCCACTTGGAT
GGGAAAACTTCAATATATGTACGCAATTGGACAGTTTCTAAAATTCGACATTCAAATATCTCTAAAATTGCAACCGTTTCTGCACCCGCCTATCGCTGTA
CTACCAGACGACCGGAAGTCAGCATCTATGTTACGGAAATGGAATGAATAATGCAGTTTAGAGCCTAAACTTGCAGCCGTGTATGCACGTTAATATGCAG
TTTGCACCGGTTATTACAACGTTCGGTTCGTCGACCATCTCTGTAACAAGTAAAAGTATACAAACACCAAGTCAAACTATCTTGCATATGCAATTTAAGG
AAAGGAAAAATCAGCCGGTTTGAAGGGGTTAACTTTGAGCCCTGGTCTTGGGCTGTAAGTGTCCTTTGGATAAGGAACTTAATATTAGTGACTCTTTGAG
TCGAACGTCTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCAGCGGAGTCACAGGCTCCTTGCGGCACACGCGTCGGCGTGAAGACATCATCTTCCG
TAACGAAACGAAACAGCTACTGGCCGTCAGGGTGGAGAGGCAACTGCTAGAACCCCTTGAATAAATCGAAACGTCCAACCCCATAAGATCCTCTCACACT
CTGCGTCGCCGAAGATAAGTTCGGCGTGGCCCCGCCAGAGGAACTGTGCACCTGTTCGGTGGTCGGTAGTCAACGAAACGCATCGCTATGTGGCTTCTTT
ACAGGAAGTGCCGGACATGCCCAGTGACTGGTGCTGTTACGCCATTCAAGTCCATGTCGCTCTAACGCCAGCACCAATTCTCGAAGAAACTTTCGCTGCT
GAGGAGGATACTTCCTCGTATCACTACGATAGGGCACAGCGCCGTCACGAAGCTTGACTTTCATAGGTTCGACATCTGCTGGCGGGTCGGCTCTGACACG
AACTCGCCACACGTCAGCAAACTCGTAGACTAGTTTGCGCAGGTCGCTGAGCAGCGCTGGCTCAAACCACGCTGCCGCTGCAGCGAACAGCATATTCTCC
AGATATACGTTGATTTCATCGGCACGAACTGCAAACGCTAACTGCGGGCTGTCCCTGGAGACATCATCATAGCCAGCATCCCCAACATGACCGCCAGCCA
ACTGTTCAAGCAATCGGTCGATATTGATACTGATACCAATATCTTGCATCGTTTTGCTCCCAAGCTGGAACTCGTCTTCATGACCATCCATCACAAGACA
CGACACATTGGTGAGATGCAGCGGTCCTGCAGCCGTCTCAACCCGCAACTCAAGTGTGACTTGTGTCTCGGCAGACCATGCGGACACCGCCGGCAACCTG
AACTGGTATGACCGGGTTCAAAGCCTCCATCTTCAACCCGCTTTCAACACCCTGCCGTTCCTCGACCAGCACACGCGATACGATGTTGCTTTCGGCCCCT
GTGTCCTTCACCCAATGCGGCCCCTTGCAGACTAGACAGCCTGACCGAGGTGGAGCTGAAACCGTCTTCGGTTCAGACTTTGAGCGCTCCGATTTACCAG
AAGTCTTATTATGCTGCTGTTTTCCACCACCAGACTTCGTGCTACCAACCGTTTTACCTCTCGGCGGGTCATAATGCTTTAACTCGCTCTGCATTATGTG
AAAATGTTGTTGGTACTTTGCACGACCGACGATCAACTCGTACAGAGCCACGTCGTCTTGCTGGTGTGTCACCGCAACGAGGCGCTCAATGTCGACACGC
AGTACCGTCGGGAACAGGTTCGAAATGAGCAGCTTGCAGCTAGTCTTCATACGCTGCCGATCTGCTGCGTCCGTCACGGGTCCTTGGCCGACCCACGCCA
TGAGTCCGTGATCGTCAACGAGCTGGTCAAAGTCCATGAAGCGCTTGACAGCACGCGCATGGATGTTCGCCACCTCCATGTCCATCTGGAGGCTGTTACG
GAGTAGCCTGGCCACGTCCGGGACGTGGTCGCTCATCAACGTGCCAGCACGGCGCGTGATGTCTTCCTGCAGGCGCGCCTCCGTCACCTCCTCCACGGTG
GTGCGGAACTCGTAGTGCGCCAGGTGTTCAAGGATCCTCCATGAGGCTCTTGATGCTAACGAGTACAGTCTCGTGCGCTTCACCCGTCGCTAAGCACCGC
TCCCCGATCCGCTCTTCATACTGCCGACGATCACGCACAAACTTCACCAGAGCAGGCTGCCCCAGGTTCGTCAGTCTTGGGTGGCTTGATGTACTCGAAT
ATCGGCTGAGCCAATTTCATCTCGACGTCTCCGTCTTGGTCAACTGCTTCGTTGTGCGTCATCGTCAATGCTTTGAAAGCCAAATTATACTTTCTGGCAA
GTGAGCTCTAAAAGGTAAAATGTGAAGTGAGATTAGAGTTAGAGTTTCAAAGTTGCTCCTAATCGGCAACGCCCGGGACCACAGCCTCAGCTCCAGCGCC
TTCGTCCTGCGAGCCACCGGTCCGCCAATGGCTGCCACTGCTGCATGCCTTCGCCCAGTCAATCGTACCGGCTCGTACCGCGGTCCAGCGACCGCTGCTG
CGTCCTCCGTCGCCGCTCGAAGGCACGCGTTCCTCGTCGCCCCTGCGTCACTCCAGTACTGCCCGCTTCTGAACCCCACTGGAGGATACCGGTAAGAACC
CGGTCTACCAGAGACCGGTCAGTTGTCCTGCTGCGTCGGTGTCTGTCGCCGCGGTGTCGTCTGGTACAAGCAGCGCCACAACCGCTCGGCAATACGCAAA
GTCTCGTAGCCTGTTGATCTTCAAGTTGACCGACCCCCGTATTGATCAATTCACTGCAACCAGCACTTGATTAGATTGGGTTTTCTTCTGGAAAATAATA
ACACTGTAAAATGCCTTCTTAATAGGTCATATTACCTTTACGTAGTCATCCCAAACATCATCGTGAACAAGCACAACATTTCGTTCAGGATCCCAGCCAA
AGCCAGAGGCTCACAACATCCCCAACACTGCAGCGTACCTGCCTTTTAGCTATTGACCACATGTGTAACGGGTACGTAGCCCTAAGTGTACCCCTACTTA
CATGAAGTGTAACACGTCATACTTCGGGATATTTGGTACAAGGTACCAAGGTCGTCCAAAGCCAACCATTGGCTAATGACATTGCTTTTCTGTAGGTGAC
TTATAGTTTGTATTGAATTCAAGCTTAGCCTACCTATAAAATATACTTAGCTTACCATCTACCTTAAATTGGTCACTTCGCTCCCTTTCGGTAAAAGGGG
ACCTGTGAACTGCCGCTCACTGAGAGTTTGTATACTCTCGGAAGCCAACTTTCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGT
AGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCATTTTCGCTAGCAGCGGCGAGTATCGGTACGGTCAGCGGATGAGAATCAACACCCGTATTATCAGGCTGACAT
TTGCAGTATGTACTCGTCTTGGACATCGTTGTAAGCGTTCAGATCTTCGTTTGAATACTCGGTGCCTCCCTGAGCAGCTTCACGACCTTCTAATTCAGCT
AGTAGGTCGAATTCCACTTCCGCGTCGCGTACATGCCTGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCAGACTACGAGTTGGCCCACAT
CACACGGGTGACAACGGATCTATATGATCGGCATACGTATGGTGTATCGGGAAGATGAGGCTGTCGCACCTATCGCCACGTTCCTCACGGCAGGAACAAG
CGGCGAAGTCCGACTGGCCCTTGTCGCGACAGCGCTCCCGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGAGTCCAATAAACC
TCCACGGGTGGCCGTATCCAATGACGAGGATATGAAGCTCGACATCCTCGCGGAGGCGCACGACGCGCTCTCCAGCGGCCACTTGGGCCGAAAGAAGACC
TTTCTGTCGCTCGCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGCTCGCCCGATACGTTAAGACATGTGAAACATGTCAGCGAGTCAAGCCCGCAG
GCCCTCGCTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGAATGTTGGAAAGTCGATGAGCCTTTGACTTCATCTTTGGGCTTCCCGCCGACGGGCAC
GGCAAACACAGGAATTTTGGTTGTTCGTGTGTCGGCTGAGCAGGATGGTACATCTTGCTCCGGTTCCCGTCACTGTTACGAGCGAACAAACCGCAAGTTG
GCTCGTCGATGGCGTGGTTTCGCTATCACGTCCTCACTGAACGATTGTTCTCGAACAGAAGACCCGCGGTTCACGGCTGCGTTTTGAAAAGCGCTCTTTC
CTTAATGGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGTTCATTTTGTGCTGATTACAGAATTAGTCAAAAGACTACCAGTTATGATAAAAGCAATTCGGATATTGTGTCGCAAGCCGCCT
TGCTGTTGTTGTTGTTGACGGTACAGTAGTGCTTTCAATTTGATAGTTAACGGATAATTTCAGGATGGTTAACATCATTTAGGCTCCAAGTTTATTACCG
TTTCTTTATGGTGGTCTACTTAGCCAACTATAATTAACACCTCTCGGGTTTTGTTGTTGTGTTGCCGCTCCATTTAAAAACGTATCCTACGCTCCTGTCG
GCGACCCGTCCGCCAGCTAAATAGTATCGGATTTTTTGCTGCCTAACAACTCTTAGAAAACAATGGCTTACAGCAGTCTCTTAGAAAACAATGGTTACAG
CAGTAACACAAATGAGTTCATTCTATTCAATCTAAAACTATTTATCTTTATGGATCAGGTGACAACGTTTATTGGCACAGCGTTGTTCTTACGGCCAGCT
TCTGCTGTACGTGTACTACTATTTGGCAGCTCAGTCAGTTACCTCACGCTCAGATAATAATTAATATTTCTACAACAAAACAGTTGTAGTTATTATTTGA
GTCAAACTTGCAGAAACTATTAACAACATAGTATTACGTATGTTATAGTATGGCCTCGAAAACACGCATTCCTACGTGTACGCTAAGCACCTTGCAGCTT
AGTAAACGTATTTTGGGGCTATTTCATTTAAAAATAAGTAGCTCTGTCTGTTTTGCACTCAAATATTAAAAGCAACATGCATTATTATAATGGTAGATAT
TAATACTTCGTAGTAATAAAACGATGCCGCCTTCGGATAATGCCTTCGGATATTGGATAGTCTTGTGCAAATCTCCATATGGGCTCTGTGAATCACATCA
ATTTATTGATATAAGTTACATAATCCCGTTTTAACCAATCGCATCCGCCTTCGCTCCGCTCGGCAGCCAATGGGAAGGCTCGAAAATCTGAGCGTTTCGT
GTGACGGACGGAAGGACACCGTGCTAGCATTGATAGTTTAGGATAATGGACTGGCCGGATTCGCATTCAGCGGCCAAGAACTGACCATCTACGGTACGAA
CCCTCGGTGGCGGTTGGGATGAGTTCGCGGAAGACTCAGCGACCCTTTGAAGGCACGTTCACCGTCTGGACCAGGGCGCGAGCCGTTAAAGATACTCATG
CGACGGTGCAGACGACGCTTGGCGTGCAAGAAGATCCATAACGGATCATTGTTCACTTGATATTTGCAAACTGGATTAGGACTTCCTTTTAGGAATAGAC
CCGAAAGGGTAAACATAAATACAGAACAGAATTTCCACTCAAGCACACAGTGCGACGTCCGGCTTCAAGGTAAGCGTCTGGTCAAGCTTGTTTGAGTGTG
TTATGCCTGTCGGTGAACTCGAAGCTCTGTAGCGAGGGTTCATCCGGCAAGGCCAAGAGACTGTATATTTTGGCCGATTACTATCGGGAGGATTTACGTG
ACGGCTTATTGTTGCCTATTTGCACGACTGGGATTGCTTGTATTGCATCCCTTTTATTCTTCTAACTGAGTGTTGAACACTCGGTGCCCTCGTAAAAGGC
TTACCCGTGCCTGGTACCCTTCCGCTGTTGGGACCACGAGGATTTAAAACACCTGCTAGCTTTGATCGTGCTAGTAGCGTGTTCTTTATTTTACTGGTTG
GCCTATATAAGCAGTTTACAAGGTCCAGTTTGTCCCGGTGCAAGAGCAGAACTGGGGTCTTCAGGTCCGCCCGAACGATCGTTTACTATCCTAGTAGACA
TATTGTTGTAGGAACGTCCTAACTACATTTGTAGCTATGGTTCACGTGGGAATTCCAACACCACAACTGGTGCCGCGACCCGGGAACAGATTGTGACCAT
TGTGAGCTGTTTGTATGGCCTTCCAGTTTACGAGCTACCAAGAGAAGAAGAACAAGAAGAAAAAGAAAACAAGAAACACGGCGAAAGGACAACCGACGGT
AGCAGCAACGCCTGCCAAGTCTGGCGGAGCGCGCAACGAGAGTTCAAGTGCAGACGTGACGGTTGCACGCTTTGCAGCTATGCACGCTATCATCGGGACT
GAGAGGGGCGACCAGGTCCTTTTCGAGGAACCTCGCCGACGAGCTAGATGACGTTGCGGGACCAGAGCCGGTCTATGAAGAATATGACGATGGGGACCGA
GTGTTCTAGACCTTCGGTGGCGAGTGCGAAGCTTCAGCATTGCTGAAAGCACCTCGTCCATCTATCAACGGTGATACACCAGCCGCCAAGCGCGTTTTCG
ACCGCGTACAAGCGCTGATGCAGAATGATGAGTGGATGCAGCTGTTCAAGCCCATCCCCAAGAAAAAAGCCGACTGGTCTGCGCTTGCGCAGGAACTTCA
ATACCCAGTCATCTCGGTTTCGACTAGCCAAGTTGCCGAGGATTCCGTTTCGCTACTGTTGTCGCTGGGCTTCGAGAACGAGACGTACCCATCGACGATG
TCGCTCCAAGATTGGAGTCCACATGAAGCCGGAGCTGCTCTCCAGAAATGGAAGAAGAAGCTTCGGAAGGCGTTTGGCGCTGTTGGCATCAACGCCGGAA
AGCGGCCTGTGAGTCGACCGATCGTTCAAGATGAAAATCCGTCCACGATTCCGCTCCCGCAGACACCCCAACGACTCGACCGTACTCCTCCGACCAAGCG
TGGAGCTGAGCGTGTGGTGCCTTTGGCACTACCGAAGCTTCACCGTACTTTCAAGACTCGCACGAGAGCCGTATGCAACGTGTATACGCTGGTAACGAGG
GTTCGTTCGGCCGCCGGGGAAGTGCCGGACGTCGTCAAGTCGACAGCGATGGTTCGTCCAGTGACGATGACATTTTGGTGCGTACATTCGACGAGGAAGA
TCCTCAACTCGAGTTGATGCGCCAGATGAATGAGCTAGCGACGCTGAACGACGTGGTTCCGACACCGAGGATTGAAATGGCTTCGCACCGACCGCTGGAT
CGCATCACGCCGTTCTCAGGCTCACGCAACAAGAGCGAGAACTGTATGCAGTGGCTCCGTGGGTTCGTCTACGAAATGACTGGAACTCACACAGATGTCG
ACAAATGGTGCATTACGTTTGGGCTAAGTCTCCGGGACGGATCCATTCATTGGTTGTGTCACTTTCCGAAGAAGACAAAACGCAAGTGGAAGCTGTTGAG
CGATGCGTTCATCCGCTATTACTGCTCGCACCTCACGCAGACGGCACTGTCCCGTTACTACTCTGCAAAGCGGGAACGTAACGAACATCTGTGCCACTAC
ATAAAAAGGCTGAATGGCTACGCTCGGACCGCCCGTCTACACGTCGAGAAGAGTGGTCGCGACGCAAAGAACACGTACAGCAGTTCTGGCAACGCGTGAT
AAATGAAAAGTTGGCGGAGAGTCTCTACCATGCTCGAGTCACCGACATTCACGAGCTCGAAGAGATCTTCGAAGATGTTCTCAAGGGCGAGGAGAGAATG
GTCAAGCGTGACAGTGAGTATCGATACTTCAGGAGTCGTGATGTGCGACGCGACGATGCGTACGCCCGCAACAATCGGCGTGATGACGGTCGCCGCGATG
ATAGCCGCAATAAACTAAGAGTGACGCTCATTGAAGCCACAATGGATGACCTACTAGCTGAATTAGAGGGTCGTGAAGCTGCTCAAGGGGGCACCGAGTG
TTCAAACGAAGATCCGAACGCTTACAACGATGTCCAAGACGAGTACAACGACTTTCAGCCCGATAATACGGATGGTGATTTCTCATTGGGATGAAAATGA
CCGATACCTCGCCGCTGCTAACGAAAATGAGCGCCGTGCAGCTGCTGAAGGCACTTACGCACGTTCAGACAGCCGTCAGACGCGTGGAAACACGCCTGAT
CCCGAGAATGGCTTCAATCAAGATCGCCGAGGTGGTGACCGTGGGTTCAATCAGGACCAACGCGGTCGACGTGACTTCAACCGCGACAACCGACGCTCAC
AGTACGGACCATGCGCGGTGTGCGGTGGCATGAGTCACTCCGCCCACCACTGTAACAAGCGATGCAAGTTCTGCAAACAACTCCACGATGCTGGACAATG
CGAACTTTTTCGCAACTTCCAAGGCCTTGCCAAATTCGGGCGTACTAAAGGCACGAAGGAGGAACTCCCACCAGAGCTCAAGGCCGTTGTTCAAGAACGT
CATTTTAAGCTAGGCAGCCAGCCAACTACAACTGGGTTGGTCCCTATCGGGCTGCCACAGTTAACCGAGCCTTCAATGGAAGCAGAGTGTATCCTTGCTT
TCATGGGGCAGAGTGAATGGCCTGATATTTACGTAACAAGTGTGAACGCGACGGAAAATGAAAAGGAGAGGAGTAGAATCCTCGGTGGAGGTGTTGGGAA
GAGAGTGGAGTGTGCTGATGCTGATGAGGGCGCCAGCGAGGGTTCGTTCGGCGTGGTTTCGAGTGCAGCGCGAGACGAGTCCAAGGGTCACTCCAAGATG
ATGAAGTGAGCCCTGGCGAGAGACAGGGGTGGTGGTCGGCCAAGAAATTCGACCGACGGATCAGAATGAGAGCTCTGGTGCAAGACGAGGTAAACGCCGA
GTGGACGAGGATTCTCCTCGACACGGGAGCGAACGTTAGTGTGATCACTGACGCCTTTGCCAATAAGCTACGGCTCCGAGACGTACCTGATCACGGACGC
CGTATTGACATTCAAGGAATCAACGAAGGCAAGGAGTCTACAACGCGACGAGCATGCGTCAAGATTACGCTGGGATGGGAGATGGTACACGAATTCGAGA
TGTGGGTCATGGCGCATAGTGCATACGTCGACGTGGTACTCGGGACCGACTTTATGATCCCAGCTGGGATCCGGTTGGACCTGTTTCACAGCGTGGCGCA
ATTGCCGCACGAAGTTCAGATCCCACTGATTAAGACCAAAACCATGATCGAGAGCGAAGGGTACGGCTCCCATGTTAACGCCGGGCCACCTGAGCGTTTG
GACATTCAAGCGCACGAGTGGCGGGAATATCGACTAGCGAAGCGTCAAGTCGAGCTGGAAGAACACGTACTGTGGGTTCGTCGAGCGAACAAGCTAATCC
CGTCCGTGGCGAGGTTTCGACGTTGACGGTCTCAGAGCATTCGGTTGACCAATGTGTCCGATCAAACTGTTACCTACCAGCACACGACTCGATCGCGATG
TGGATTCCAGATGGAGATTTGCCGCGAGGTGACGGCTATGTGCGTCTGGATTCCAAGAAGTACCAAGACTGGCAAGTGCTGGCCTACAAAGGTTGTAGCG
ACCGCGAGCTGTTTCAGCGTGAGTGTGAAATCTACGAGCAATGGCTCGCAACTCAGCCTTCGGCGGTCGAGCGACCAGACTATCCAGAACCAAGTGGGGT
GCTAGCAAGGCCTCTTGAAGACTCGCTAATGGACTGTAGTGATCGTCTGGCATGTGTAGAGCGCTGGGCAATGATCATGGAGGAACGTGAACGAGTGGAG
GCCTGTCTGGCGTCTGGGGTGACAGCCGGGGACTCGACCGGTGATCAATTTTTCGAAGAGCCTATGAACACTTATACGACAGTTCATGGCGGAAGCAATA
ATGCAAACGAAGCCTCGGTAGCGCGTACACACGAACTACAGAGCTCGGTAAACGTCGTACATACGCCAACGAGTGTTCGTTTCAAGTCTGTGGTGACAAC
GGAAGCGACAAGTAACAGCACTGGATTAAATGGAGTCATCAGTTTTGACGAAGTTGTCCCGGCCTTGTGTGCAGCCAAATCTGCGAACGAGACATCGGTG
GTTGATCCAGAGGATGCAGGCATCGCGTTGAAGGTGTTGAGTACGGCACCGAGTATTCATTGCAAGATTGGTGCGAATGCCGAACTGTCAAGACAGCGGC
AGAACGAGGAGCTGAACAAAAGTCAACAGCCCAATATGTCGGCCGCCTGCGCATTCAATATTGCGAACAACGACTCGGCAGGTGGCCCAGGGATGGAAAA
CCAGGATGGGAAGGAGATGGACCCAGTACCGACTGTTGAAATCAAAGCGAATACCGATGTTGAGTCAAGAGAAGAATCCGTAGCGACTTTGGACGGAACG
TACATCTCGGTTGCTCGAGTATTAACGACCGAAGGAAGGAGGAAACGAGAAATGACTTCTACGAACACCCGGTTAGCAACATTGGCGTGGAAGACTACGC
GAAGGAGCTGGCATTCCTGCCGGACCTGACCGAAGTTCGCCATTACCGAGCTTTCGTTTCCAACGAGTAAGAAGGGCATGCAGTCGTTTCTTGGAGCGGT
TAATTACTACAGCCACTTCATCCAAGACTTTGCTGTCTACGGTGCGGCGCTGTACCAGCTTAAGGATGAAGACTTTGCCGTTGAAGGTGGCCTTTCTGTG
GCACGTCGTTCCTTCGAGAAATTGAAGGCGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAGGCATTTCACGTCATGCTCTTTGCAA
ATGAATGGGCGCTGAGCACTACGCTCATGCAAGAACACAAAGGCAAGTTGTAGCCCGTACGATTCCTCGGTCTTGTGCTCAAGGAATCCGAGATGAACTA
TCATCCTGCTGAGAAGGAATTGTTGGCGTTACTTTTGCTGTTGAAGATATGTTAAGTCCAGCTGACAGGAAAGACGCAACATGTATATACAAGATTCGCG
ACGTTAGAGTGGGTGCATAAATCGAAGTCTCTCTTCGGACGCGCGGTCCAGTTTGCTGTGCTGCTTTCGCAGTGGCATTTGAAGGTACAGCGCGTGAAGG
AGAACGAGGTCGCCTTCGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTCGACTTGGAAGACTCACTCGCGCCGGTGGCACCTCCAAACAAGGGCTC
TCCGACTGTTCGAATGGACCCCGCGTTACTTTACGCCAGGCTTCCCCGTAATTACTGTGGATTTGTCATGTCATTTGACGGATCAGCGAAGACAGAGAAG
TACGGTGGCTACGGGAACTGTTCATGGGTGTTGTGGGGCCTTCCTGAGTGGAAGATAGTGATTGCTGCAAATGCTTACCTCTCGGCTGCCACGGTGAATG
AGACGGAGTACACAGGGATGATAAACGGTGTGAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATCGTTGGTGACTCAAGGCTCGCGATTCAACA
ATCACTAGGGGTGATCGCATGCAGGAAGGAAACTCTGCTAGCGCTGCTGAATATTCACAAGGAACTCGCGGCCAAGCTTCGATCAGTGAAATACCTTCAC
GTTGTACGAGAATACAACGCTGCCGCGGAATCATTAGCCACTGAAGCACTGGAATCAAAGGTCAGTCGTGTCATCTTGGCTGAAACTCGCAAGTCAGAAT
TGGCGTCTCTGAATCGTATCCAAGAAATGATCTACGAGCCGGATGAAGACTCGGTAGATGTTTCGTCACGTGGAGCAGAGCGTCAAGTACATGTACTGTC
AGGCAGCGAGTCTTCAAAGTGTCGCAAAATTTCGTGGTTGATTACAGCTCACCAGAGTACGATTTGGTAATATTGCAGTGATGACTAGGCGACAGACGAA
AGCCAAGAATCGCGTCAGGTTTGCAGATGAACACTCGGAGGGGGTCTCAAAAGCTCAAGAACAGCATGAAGAGCGACGAGAGCCGTCCAACGAAGACTCA
ATCGGCGAATATTTGCCAGACCATCCTCACAAGACTGTACCAGCGGCATTTCCCGATGCGGAGGATGTTGACCCGGTAGCAATACAGCGGGAACGACGCA
GACGGATAATGGTGGCACAAGACGAGGAGCAGAAGTGGTCTAACATCAAGAAGGTACTTCAGGGCCAAGCAGAAGAGCTGAGTTACAAAGAAGCTCGAGA
TGCCTGGAAGTATGCTGACCGGTTCGTGTTATCAGAAGACGGCGTGCTTCACTATCTTGGACTGAATCGTCGGTACGACCACGGTTGACAAGAAGAGACC
AAGCTGCGGCTTGTGGTACCGACAACGATGATCCAAGAGGTCTTGCAGAACTGTCACGACTCGCTGGAAGGTGGACATCAAGATGTGGTTAGAACGTTCC
ATCGTGTTAAGTCCGATTACTATTGGATAGGCTTGTACGCTGACATGGAGAAGCATGTGAAGTCATGTCCGGTTTGCAGCTCGAGTAAAAGCCGTCCGCA
GCTTCGTGGGTATTCGCCTGGCAACGTACTAGCCGAACGACCGTTCAAGATCGTCTCGATGGACTTTGTGATCCCACTACCGAAATCTCGCCGGGCAACA
CGGCGTTGCTCCTATTTCAGTGCTCGGTCACGGGATTCGTTATTGCCGAGGCTATGTCAGATACAACGGCGCTGAGTGTTGCTCAAGTGTTTAAGGAATG
TGTGTACCGACGGTTCGGAACCTCATCATTGATCAAGCACGACCGCGACCCACGCTTCAAGAGCGAGGTGTTCAAAGCATTCGCGGAGATGATGCAGTCA
AGGTCACGAGCTACTTTGAGCTATCGGCCACAGGCTAATGGACAACAGGAACGCTCGGTGAAGTCGATGATGGCTTCCGTACGAGTGTACGCGGAGGATC
CGTATCAGCAGGATTGATATGAAATCGCTGAGAGGTTGGTATTTGCTACTAATACCTCTCAGGATACTACAAGGAAGGAGACACCGTTCTACCTGATTCG
TGGTTGGGATGCACAATCGACGTTGCGGGTAATGCATTCGTCGCTCAAACGAGGATTCAGCAAGCCGTCTGACGCATTGGCGTGGCGACGCGAAATCAAT
CAACAACACGAGATCGCCCTCTCTATGGCCGAAAATTATCAGGCTGTAGAAATTGAGCGAAGAGCAAAAATCCATAATGATGCCCTGACTTGACTGGAAA
AAGCTGCTGTACCTCAACTAAGTGGAAATGAACACTCGTTGGACCCTCCAGAAGCTTCGGAAGAGACAGATGACCCTGCAAGAGCCCCACCGAGATCTCT
TTTTGAGATTGGGAGCCGGGTGTGGTTGTACATGGAACGCGTCAAGCCAGGCCTGACGAAGAAATTAGCTCATCGGTGACATGGACCTTTTCGGATCAAG
CGCAAGGTGGAAGAGTTTACGTACGAGCTGGAACTGCCGCGCCGAAGTGGATATCGCTTCTACCCAGTAGTGCATGTGTCGAGACTCAAGGCTGTCAACG
AGTTCAACAGTCGACCGAACGCTCGGTTGGTACTAGATGCGACTAATGAAGCAAGACTCGACTTCGATGAGGAACTATTGCCTGAGGACAGCTGGGAACC
AGATCAAGTTGCCGGTGAATATGAAGTCGAGGCCATCCTCGACGACAAGAACACCACTGTCGACGAGCACGGAGCGTGCTGTACGCAAGTTCAAAGTCAA
GTGGGTGGGCTATGAAGATCCAACTTGGGAACCACCATCCAACTTGTCATGTGGAGGTCTGCTGTACGACTATTTGCGAGCGAAGAAGAGCGAGAATCGG
CTGCAGATGGCGCAAGTGGCGGACGAAGACTAGCGTGACTGGATCACGTGTAAACTGTCCACAGGGCGATGCAGCCTGTGGTAACAGACGAAAAACGTTA
CTGCAACAACAAATTGTATATGCATTTGAAGAACAACATGAACATGATTACGCTGTGGAAGTGGATTAAGAATAAGAAAGCATGAATGCCGACCGCAGTG
TGACCACTGAAAACAAAACCTCGCTGGACCCCTCAACAGTTAGCTGGGGTGTCGAAGAACGTCGTGGAGCATGCAGCGAGGATTCAAAGTGACTCCAATT
GCCTGGCAGCGGTGGTTAAGAGTGCCAGCGAAGTTGAGTCCTCACTCTCCTTCTCCTCGTCATCGGGAACCTGAACCTCGGCCGCTGGAGCCGCATCCGG
AGCCTGCAAATCCTCGGCACCAGCTTCAACAGGAGCAGCATCCAGAGCGGGACGTGGAGAGTCAAACAACGAACGCCAGGTCGGGATAAGTTCAGGTGAA
GCCACAGCCGGATCAACGACCACACTGCGGTACACATCAACAAAGCGCGTACCTCGAGGATTGAAGAGCTCCGGATTACACTGGCACGGGAAGTACGTGG
TGTTGTACGGGTGCTGGTGCGGCGCATTCATCCATCCAGTACGCCAGGGCTGGCAAGAATCGAGAGCCGGAGCTTCGGAAAGCCAGTCAGATGTCCGAGG
TGCGAACGACAAGTTCTCAATTGGGTACTACGGCTTTGATGGCTCCAAAAGCAACTCGGGACGAATGAACGGCGTATCGGAAGTACCGGAGGAAACCGAG
TCACGACTCCACGCCATGTACTATTCTTGGTACTTGTTACGGAGACGATCGGCACGACGGTCGCGCTCACTGAAGAGCTTCTTCTACAGAGCTCTCAGCT
CCTTCAAGAGCTCCTTGTCGTGACCGACCTTCTTGGCTTTCTCGACGAGACCTCGCTCAATACCGGCCAACGGAAGCCAGTGGAGACGTTACCATAACGC
AAATCCGAGGTCACCCTGCTTGCCGCCGTCACCCCGAAGATTCGCCCAGATCATCTTGAGGCGGGTCTCAATTGGAGCACGCTTGGAGATAGGGACGCTT
GGATTGAAGTTAACAGTGTCGAAGCGACAAGCTTGAAGAGGATAGAGCTGCCGAAGTTGCTGGTACGGGTGATCAGGATGCGAGTAATCAAAAAACGCTT
GGAGACCCTCCAACGTTGTACGCACGGTCACCTCACCAGCTGGTTCAGGAAGGGTCATGCTCAAGAGTCGTTCGAAACACTTCTTGGCACCTGCGTCGGT
GAGCTCCATGTCCAGGTACGGGAGAACCCACTGTGGCAAGGTGGACGAGGCCGGCACCGTTAGCGAGCACCAGGCAACACGCGGTGAGGCAACGGCTCAG
CCGACGGTACGCCGCCACAACGTGGCACAGAAGTGTAGGCGGCCGTGATCTTGCACCCAGGCCCACTATCGAGAGTCCGAGAGAGCGGACAAGGAGACGC
CGGAGCAGGAGGCGAAGATGGCGGTGCTTGTGGGCTTGGCGATGGCGAAGAAGGCGGACCACCGACTATGATCGGAGAAGTGACCATCGGTAAAGGATTT
GGCCGAGGAGCAGTCTGAGGCCGAGCAGGGCCAAGACCGCTCCAGTTGCCGTCGGAATCTTCGACAGCTTCGTCATCAACCGTACTTGAATGTTCGGTAG
GTGACAGAACATCACCGCCACCACTTGCACTATCAGGAGAATCACCGACCGAAAGCTCATCGTCATCCACGTTACCTCCACGATCATCATCACCATTTCT
ATTGTCATCAATCTCCATCGGAAAGTCGGGCGAAAAAACGCTTGGCACGGCAGCTGTTGGAACAGTCGGAGTCGGCGTTGAAGACACGGAGGCTTGTGGA
GCAGCTTCACCAGGGGCAATCCCTGCTGCAGAAACCACTCCCGAGACTTCAACCGTCTTGGAAGTCACAGCAGACGACGAAGCAGCCTTGCTTTGTGGGA
CATTGTTGTCCGATTCTTCACCTTCGTCACTTGAGCCGAACATTAGTCGCAATTCCTCAGCCTCACGCAAAGCCTCTTCCGCGGCACGTATGTCAGCTAG
AGAAGGAGAGATCGTCGACGCTGGCGGCTTGGCCACGTCAGGAGAACCTTGAGGTAGAGACGAAGGCGCGTCGGGAAGACCGATTACATCGTCGTGAGCC
CCTGAACCCACTGCTTTGCCCGAAGACTCGGTGGAAGTATCTTGAGCCGACGGGGCCCCACTTGAACCAACATCCACCATGTCCACGTCACTCTGGTCAC
CGCTGAGGTCACCAACGGCGGGAGTCGAAGATGACGCTGGGGTCCGATGAGGCGACCATGAGCAAGAAAAGACGGTATAGACTTAGAACGAGTCTTCATA
TGACGTCGGGCGACTTGGCAGGAGAGCGAAGGCGAGTCTTCTGGCGCTTCTTCTGGGCCGCTTGCTTCCATGCCTTCGGGCTGAACAGCGACCGACGAGC
AGCCTTGGAAGTGGAAGTGTCGGCAGGTGGCGCATCACCGAGACCAGCGGCTGCCATTGAGGTACTGGTCTTGTCCATCGGGATGGGAACCTTGTCTTCA
TCAGAGTCGTCCAACTCGTCGTCTGAATCCTCGCCACCTGGTCGAAGGCGCTTATGGGACTTCCCATGGGCCACTTGGTGAGCGGCCTTTGCCAAAGCTG
TAGGAAGAGCTTGTGGATCGTCCGAAGACGCGGCAGCCGACTGTATGCGCTGAAAAGCGACCAACGTCTCTTGGTCCAAGTCCAGAGCGTCCAAGTCCAG
CTCACCCGCAGTAAGACCTGTCACGAAGGATTGTGAATGAACGTTAGTTGCTGAACTCGTGGTGGGAAGAACAACGTGAAGAACGTACCATCAACGGCCA
GACGCAGTACCTCCGGATCCATCCCGTCCAGACTCGCGTGTGCACGGAGAGTGCGATTCACTTGGAGGTGGCGAGTGTTACGATCTTGCTGGTTCTCGAG
GGCCTTGAGCGTGTCGTTGTCATCATACTTGCCCTGGGCAGGCTTGACCAAAAGGAGATGAAGCTTTTAAATCTGCTCGGTGTTCGCACCAATCGAAGAC
TTGTATACTTCGCACTCACGGGTCAGCTTCTTGCTCAAGGTGGCGATAAACGCGTCCCGCGCTTGGACCTCGCAGTGCAGACGATTCAAGTCTTCTGAAT
GTTACTCCATGGTGGCCTGAACACTCGCGAGCATGGCATCGTTCTTGGCGTTCGACTCGCGGAAAATCTTGACGTCCTTGCGAAGAGCTTCGACTTCGGC
GTTGGCAGCCTTGAGGTACGCCTCCGCGTTCTCCCGATCCATGATTTCGGGTGCCACTGAGCGCACGGCGGCAGCAGCCTCGGTCTGGGCAGCCCGCAAC
AGACGCTCCAAGCTGATAACTCGGTCGGGCAATGCCGACAACGCATCAGGAAGAGGCTGTACGGCGGCGAGGACTTCGTCGAAGCCCATGGCGGTCTCGA
GGCGACGTTGAGCGTGAACATCGCCATGAAGAGGAGGCGCGTGAAGAGGAGGCACAACGCTGAGCTGCACTTGGTGACGAGCCATCGCAGTCAAGCACAG
AATTTTAGAGGTCATCATATGATCGACCGACGCCTCCGTACTTTCAGCCAGCATGGCGCGCAATGAATCCTCGGTGAGTGGTGGGGGGCCACTAGCAGAT
GTAGGCGGACCGGTAGGAGCCATCCCCGTGGATTCAGCGACGACAGGGAGTGCCGTAGGAGCTGCAACAGGTAGTGAAGAGTCCGGGGTAGGAAGCGCCG
GAGGTCCAGCTGATGACGTTGCCATCGAAGAAAGTGTGGCAGGCTGAGGGGCGTTCGAAACCTCGGTGTCGCCCTCCTGAGAGACAAGACGAGTAATGCA
TGGTGATGAGCAAGGCGCCGATGGTTCAAGAGGAAGACAAGCTGACGTACCTTCAGCTGTTCACGCTCACGTCGTCGGCGAGGGTTAAGAAGTTGGATCG
CGTTGTTCACGGCACGATTGAGGCGCTTGGACATCCTGAGATTGAATGGTGAATTGGAGAATGAAGAAATGTCACAACGGGCATCATTACCGTGGCTTCC
ATTGCGACAGGGGTAGTGTGGTGTAGTGATTTGTCCATAGTTGCGGAAAATCGCCCGTAGACAAAGACGCTACACCGCCCAAGATGTTCAAGCGACTAAC
CCTCGGTCAAATGACGTACGGTGACTCCAAGGTGCAAGAGACTCGACGGCGTCAGTACCGAACTCTCAACAGATATTGGATACGGTCCATATGTCACTGA
ATCCAGGTTGTCCTTATTATTAACTAGCCGAGCGCCGCCGCTACGCGGCGGTAATTTAGGTTTAGTTCAGCTTGCTTTGGTTTTCCTGCCTCCGCTACGC
TTCGGCGGGATAACTATTGAAAATACGCTGAACCCATGTGTACCTAAATCAATTCTTTTTAATTTCATTAATTTGGGTCAGCATGATGCTTACCTGATTT
AAGAAATAATAATTCTAATGATCTTGAATCAAGGTTCTTGATGCAATCTCTTTTTTATTGCCGGCTATCACTGTATCTTCATCTTCCACCCAAAACCACC
AGCACTTCAAATAACATTTATACAAACGCTTCACAATATGTTTCGTTTAGCGTCGTGTTCGATATCTCGGGCCATTTCTGAGCCGCTATGACACTTAGCT
CACATCAGTACAAACGATAGCAATGGCCTGTCCAGCTTGCTCTACTTACCTGCATGTACTGCCTATTACAGCTTGAAAGTAACTAAAAATTGTTCACTTC
TCATATCAAGCTCAATGAAGGCTAAAAATGTTTTTAATGTATGTAGCGTTCATTTTGTGCTGATTCAGAATTTGCACTCGAATCTGTGCCAGTTATGATT
GAAGCATTTGGATATTGTGTCGCAAGACGCCTTGCTGCTACGGTAGTGTTTTCTATTTGATAATTTAACGATAATTCCAGGATTATTGGACGTCATATAG
GCTCCAAGTTTATTATCGTTTCTGTATGGGGTTTACTTAAACATATTTAAGTAGACCCATACAGAAACGATAAGCCCCCTGTATGACCATTTTGCTCCTT
TCTCTTGGCTTTATCGCGGCGCTAATAACGGTCCCTTCGTGGCTTCTCGCGCTTCTGGCGTGCTACTGCGTCTGCTCCAGACCTCTTACGCACTCAACCG
AGCCTCCATGTCACCTACAACGGGCGTGGCAAACACCGACTCGGAGCTGCCTCGGCGGCTCGACTCCGACCAACGGACTCGAGTATCGGTCCTGGCTGCA
AGATCTCCCGGAGCGCCAAGATGAGGTGTCCGAGCCTGTGTGTGTGTGTGCCACCCCGTGGGCAAGAGTGTACGGCGACAAGCTCTGTGGGATGTTCGAC
GTTGGGTTAGTTGTAGGTGAGAGTTGGATGGGAAGTGGGCGGACTGGCGAGGCCGAGGTGGTAGAGCAGCGCGAAGGCGCGCAGAAGCGCGTGGTGCAGC
GTGCGTGCGTGTGTATCCAGTCGTTTTGTGATGAGGGCGGTATTTTGTTTTCTTGTGTGTTGTGTGCGATTGGCGGTCGTATAGCTCAGTCGGTAGAGCA
CAGTGCTAATAACGCTGCGGTCCAGGGTTCGAGCCCCTGTATGACCATTTTGCTCCTTTCTCTTGCTTTATCGCGGCGCTAATAACGGTCCTTCGTGGCT
TCTCGCGCTTCTGGCGTGCTACTGCGTCTGCTCCAGACCTCTTAACCGAGCCTCCATGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTAAAACTACAGTATCTATCTTTATGGATCAAGTGACA
ACGCGTATTAACAAAGCGTGGTTCTTACGGTCAGCTCTGTTGTACATGTACTATGATTTGGCAGTTCAGTCAGTTACCTCACTCTCAGATAATCTATTTA
TATGTCTACAACAAAACAGTTACCAATAGTCATTGTAACTTGCAAAACCTATTTAAGTACATACTATTACGTATATTTATACAATGTCCTTGGAAACACG
CATTCCTACGTGTACGTTAAAGCACCCTGCAGCATAGGAAGCATCTTTAGGGGCTATTTTATTTAAGAATAAAAAACTCTTTCTGTTTAGCACTCAAATA
TTAAAAGCAACATGTATTAATATTCTTAAAATAGGGAAGTCCTTCGTAATATTAAAGCGATGCCGCCTTCGGATATTGGATAGTCTTGTGCAAATCTCCA
TATGTACTCTGTGAACCACATGCATTTATTGACGTAAGTTACAAAATATTCGTTCTAACCAATCGAAGCCGCCGTCGCTCCGCTCGGCAGCCAATGGGAA
GGCTAAAAAATCTGAGCGTTTCGTGTGACGGACGGACGGACACCGTGCTAGCATTGATAGTATAGGACTAGCCGTTCGCCGTCCCTACGCGGCGGAGTGG
CATGGTTTATTGAAGATAAGGTGGCCGCAATTTTAAGTACTTCGTAATGCGCTCTCTCTTTTGGGATCGTGCTCTTGAGTAGTACGATTTGGCTGCTAGT
TATTCCGTGTTCCCAAGGTCTTGAGTGGGTTTTACAGGTTTTGTGGTCCATATTCATTCATGGTTCATGGCGTCTCATCGACGGTATCCTCGTCGTTGGG
TGCTATTCCGTAGTTATATGGATCCGTCCCCGGTGTAGCGTGCTCTCCTGGTGTGGCTTCATCGACCGCGTTATCGCGCTATCATGCGATCGCAGTATGA
TCCTGCTATCCTATGCTTTCGTGCTTAGTGCATCTGTGTTTCCCGTGTTATTATGTTCTACAATGGCATACTGATCCACGTTGTGCAATCGTGATATCCC
GAAGCGCTCCCCGTTGCTTCCGTGGCTGATCTGCCGTCCGTGCAATCGTGCTATCGCCTTCTGTGGCTCCGCGATTTCGCGTCTATAGCTCCCGTGTCTG
CGTGTTCTCTCACGGTTTAGTGGCTGGGCCACCGTCCGTGCTATCGTGTTATCTCGCGGTATCGCGGTTGGTCTGTCGTCCGAGCTATCGTGAGCTACCG
TAGTATTGTGCTCCGTGGCTTGGCTCTACCCTGGTATCGTGCTCCAATGCTCGGTGATTTTCCGCTTATGCTCTCCCGTGGCTTCGTCTTAGATTCATCG
TCTGTGCTTCATGTTCTACCGTGGTGTTATGGGAGAATTGCTTGCACCTTACTGTTTCCGTGGCCCGTGGTTTTCAGCATGTTGGGGTGTCATTACTTCA
GTTACTTTCCGTGATCCGTACGCTCCCATCATATTCTTGCCATTCCAATTTTTATGGTAGCGTGCACGTCCATGGTTCGTGCTTTTCAGAATCGCTTACT
GCTTTCATTGATTTTGTCCTCTTTCAACGTCCGTGGCCTTCCGTGCTTCGTGTTCTTCCCTCTACCCCATCGTGTACATAGTGTGACTCGGTGCTCCTCC
GTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGCAA
TTTTTATTCAAATTGCGGGCCGCCTTCGCTGCGCTCGGCAGCCAGTAGAAAACACGTATTAGCGTGAGTTTAATTAGCCCTAGCCCGTTACGGACGGAAT
GACGGACGTAGACCAGACTCCAATAGAGATGTAAGACTAGCCGTTCGCCGCCGCTACGCGGCGGAGTGGCATGGTTTGTTGGAGATGCGGTGGCCGCAAA
TTTAAGTGCTTCTTGGTTTCGCGTACTTTGTTAGCGTCGTTCACCACGGTAGGTCTTGGCTTCGTGTACTTAACTATTTACCATTCCGTAGTCTCATGCG
GACCCGTATAATATCGCTGTTTGGTACGCTTCCGTTACCCCGTACTACAGGTTGGATGTCATGTTCTACAGTGGCCGGCGCTCTTCCGTGATCTTTCTGG
CTTCGTGGTTCCCTGCTCACCCGTGGCCCACGCTGCTTAGTGATTGTCCTGGATTTGTAAACTCATTCTCTCACAGTGCTTAGTGGTTGTGTGCTAGCTC
CTTTGGTCTCATGCGCTCCCGTAGTACGACCCTCTTTCGTGGCTGCTAGATATTCCGTGTTCTCAAGGGTTTACGTGGATCCCACAGGCTTCGTGTCCAT
AATCATTCATAGTCGATAGCGTTCCATTTCCGGTACCCTCGCCAATGGGAGATCTTCCGAAGTTTTCGGTCACATGTGTGCCGCGCACCCCTGTGGTGGC
TCCATCTACCGCGTTATCACGCTATCGTGCAATCGCAATGTGGTTATGCTGTCTATGCTATCGTGATCGCATAGTATATATGTTTTGCCAGTGTTATCGC
GCTCTACGATGGTTCCGTGTCCGCGGTGTGCAACCGTGGTCTCCAGAAGCGTTTCCCCGCGATTTTGTGGCTGGTCGGCCGTCCGGGTAAACGTGTTTTA
ATGAAGTATCGTCCTCATGGCCCGTCGATCTCAGGTTCTACAGTGCTATCGTGCTTAGTGGCTCGGTGATTTCCCGTGACTGCTTGTTCTCCCATGATTT
AGTGGCTGTCCCATCGTCCATGCTATCGTGCTATCGCTTGGTGTCGCGGTTGGTCTGTCGTCCAAGCTTTCGTTATCTACAGTAGTATCGCGCTCCCCAG
TGAGCTCCGGTTCTACCCTGGTATCGTGTTTCAATACTCGACAACCTCCCATTAATGGTCTCCCGCGGCTTCATGCCTGGTCTGTCGACCGTGCTCCATG
CTCTACCGTGGTGCTACGGGAGAATTGCTGTCAGTGCACTCTTACCGCTACGTGCTTCGAACGTGCGTGCGCTTCCGTAGCCGTGCTCTTCAGCATGCTG
GGGTGTCTATATAATTAGTTCCTTTCCGTGGCCCGTACGCTCTCGTCATATTCTTGTCCTTCTGTCCTTTTCATGGCTGTGTGCTCTTCCGTCTTTCGCG
CTACGCATACAACTTTGTGGTTTGCATCGGCTAAGTCTTCTATCATCGTCCATGCCTTCCGTGCTTCGTGTTGCTCTTCTATCCCATCGTCTACATAGTG
TGGGTCGGTGCTCTTTCGTGTTTCGTGTTCTTGCTTAGTCGCGTGCCTCCGCGTTAACTTAATCACAAACGCTGCTCCGATTTTGTTTGATTTACGCAGC
AAATATTGTTGGAAAGTTCGCACAATATCATAAGGTCGCACACTACGCGCGCAAATACAAAGGAAGATGATTCTTTTTGCCGCAGACAGTGTGGGGTGCA
GGGGTGTAAGCCACAATAGTCATATTTTATAGTTTTCACACTATTATTAACTTGATACTTTAGGATAGTAATAAATAATAATTTATTATCGAGCGCTGAT
AAAATAATTATGTGTACTAAAACGTACTAATATCTGCAAGAAAAAATATGATATATAAATCTTTAGAATAGTACTACTCTAAGCTGTTTTGTTAGTTTTA
TTATTAGAAAAGTACTACGAAGCCTAAAATATAATTCTAAAACCAATAAGTACTAAAGTTTCGCTTGAAGGCGAAATATGAGTACTACCATTTTTTTCAA
CAGCTCCTACGACGATATAGTACGTGTGTGCTCATCGACGCCTTTTAATTATGGTAACTAACGCGCACACAGGCAGCGCCCTTTGCGTGGCCTTGCGAGC
CGCAGCTGAAAATGAGAGCAAAATAAAATTTGAGCTGTGCAATTAAGTACGATGTGTAGTCCACATATAGTGTGTACAAAACACAATACCGATTTTAGCC
AATGGGGGCCGCCTTCGCTGCGCTCGGCAGCCAGTAGAACGCGCGTATTAGCGTGAGGATTATTAACCCTAGCCCGTTACGGACGGACTGACGGACGGAC
GGACAGACAACACACTCCACTAGAGAGGTAAGACTAGCCGCTCGCCGCCGCTACGCGGCGGAGGTGGCAGGTTTTAGTCCAAGGAGTAATGGGCTCCCGC
CTTCGCTACGCTCCGGCGTAAACATGATTTATGTAAACGTGATGTATTAAATGCATATGAAATTGAACATTCCTACTCTCAACCAAAGATCTGCCTGTAG
ACAATGTTCTGGGCGTAGACCCCATCCTCCTCCTCCAGCTTTGGGTACTCGACCAGCGCCTTGAATCTTGATCTTGAAGTAACTCGCGACATCGCAACGT
ACAGCTGCCCGTGGGAGAAGCAAGGCGTAGCAAGATACAGCCCCAAGTACTGCACCGTTTGTCCTTGCGCCTTGTTAATCGTCATCGCAAAGGCCGGTTG
GACAGGAAACTGCTTGCGTCTCAAATGAAACGGAAAGCTCCGAATGTCTCCATCACTGATGAAAACAATGCGGGGAATCAACACATGTTGCCCTTGTCGC
TCACCTGTCATGATTGTGGCGTGGATGACATGTGGCTTGAGGGCCACGATTCGAAGCCGTGTTCCGTTGCACAACCCTAGATCTGGATTTAAGTTCCGTA
TCATCATGATAGGCATTCCTACCTTGAGAGTCAACTTGTGGGGAGGCATTCCACTAATATTCATCGAGTGGAGTACCTCCTGCTCGAAGAAATTGCCGTC
ACCGTCGTCTTGAACAGAGTCGGAAGACATGTATTCCCGCACCTGTCCAGTTAATCGATCGGTCACCGCTTCATTGATGCGGTGCACGATTGCGTTCGTG
GTCGTGAGGATCGTTCGGTTAGCGAAGTACTCGTCGGTAGCAACCTCGGGGTTATTAATCTCGCCATACATCTCGTCAATGATCCGATCCATGCCTCTTG
GAATAACGCCCGGACGAATTTCCTGGTCCTCGTCCTCTGGCACAGGAGGATTCTCAATCAGCATATCGCGCGGGATCTTCATGTAATCGCTTCCTAGGGA
AGGCGTTACATCATGCCTTCCCTCCCCGACTTGCAGCAGGAACTCGGAGAACGCAGCCATTTCCTCACCAGTGTCTGCAGTATCAGCTGTGCGCACTCGC
ATGTTTTCCGTAAGACGGAACGTCTGGAATTGGGGCCACAGCCTAGACGACTTGAGGCAAGCGTCAATTGTCTCGACGGGTGTTCCATTCTTAACGACCG
GGAGAATCTGGCGGAAATCTCCCGAAAGTACAAACACTTTCCCCCCAAAAGGCTCGGTATCGTTGTCAAGTATGTCCCGCAGTGTTCTGTCTACTACCTC
GAATGCGTGGCGATGGGCCATAGGTGCTTCGTCCCAAATAATTAAACTTGCATGCTTGATCAACTCCTAAATATGAGAGTTCTTCCTGATAGCGCACGTC
GAGCTCTCGTTCAATTTCAAAGGGATCTTGAATGTAGAATGAGCTGTCCTACCACCCATGAGCAAGAGTGAGGCAATACCGCTAGACGCCACAGCGATGG
CGATTTTTCCCGAGAGTCTGACTTTGGCCAGTATGTTTCGAAGCAGTGTAGATTTTCCAGTACCACCCGGGCCATCGACAAAAAATAGTTTCTTGCCTTC
CTCCGGGCATTCAACCGCTTCAATAATCTGGTCGTAAACCACCCGCTGACTTTCGTTTAGCTGATCTTCTGTGCTTACAATTGCCTCCAAAGCTGACGCA
TCGTATCCAGTGAGCTCACGTCGTAGTAATCCGTTTTGGCGAAGCGCTTCACGAATCAATGTTGGGAACGACCCCAACTGAGGAAGTTCGTCGAAGTCAG
CTACCGCATACCCACTCACTTGAAGTAGTTCTTGAATGCTCATCAGCGTTTCAAATTCGACCAACGCCGACTTAAAGGGGTCCATCAAAGCCTGATATTT
GCGTGCGAAGTCTTGGGAAAGATCCGCGAAAAACCGATCCCATAGAACACCAGCATTTGCTGGAGCTGAATACACCAGAATGGTGACGAAGAGCTGGCGT
AGTTGATACGGCATTTGGAACTCAGCCGCTTCCCTCAAACACGAAACCCACTCGTTGTCATTCTCTAAGTAGCCAGCCTCCCGCGCCGCAATTTGGAATG
TTGGGAAGACAATCCCGTTAACCGTTCTCAAGTCTTTAAACGACGTTGGCCCTCTACGCTGACAGAGCAGTAGCCGAAGGTAGAACCGCTCCATATCTCG
AGGAGACACGGGTGAATCATGCGACCAACGGCAGCTTGATACTGTTTCCGGCGAACCCACCTTTTCGGTTGCCCTTTCTCCGGCGCTTTCCAGCAGAGCT
CTTTGGGGATATCCTGATACAACATCGTCCTTGCAATATGATTCTGAGGCTCTTCACTCTCACACAACTCAAAGAATCTGGACAGCATCGTGTGACTACC
ACGTTCCAAAACCGCCTCCGGGTTTTCCGTCTCGCGAAAGCAAATTGTCTGGCCTGACTCGAAATGAACCGTTAGCTGTGTCACCGCATGGGTTTTCCCC
TGAATTGTGAAATCGAGCAGGCGCATGCAAGCTTCCACCGGAGAAATGTACCGGGCGCTCAAGAAACGTAGAATCTCATTTGGTTCTCGACGCGCACTCT
GCTGCCCTCCTTGGACTTCTTCCACAGTGAGTATAGCCATGTTGGGTCCTTTGTACACATACTTGTATAGGTATTTAACCGCAGTTATATCCGTGCACAC
TTCGACATTGATGTGGCAGCTGTACTTCTGGGATAAGTACGGGTTGTACGGTACAACCCACTGGTTGATCGTAGCATTGTCGTATTCTCTGCCTTTGAAC
TTTAGAACACCTTCTTACCGTCGACGTCGTCTGTACACTGGATATCCGTTGGCATTGGCTTGTGTAAATTCTGCTAAGGGCTTCGGATATCCTTTGGTAC
ACTTGCCGTCCTTCGTACACGCGCAGGAAGGGTTTGCAGGCCCGCATGGACCATGGAGCATGCATGACATGACCGTCTCATACAGCTGAGGGGTTGTATC
CTTATCTGGGATCTCAGCGCATACCATCTTGTCTACGATCTCGCGGGTTCGAGGTTTGTCTTCGTCAGCCAAAATAACCAGTACGTGAGCGTGGGGGAGG
CCTCGTTTTTGAAACTCGACAACGTAAATCCGCGCGCGCACTCGTCCCAGAACGCCCTGGTTTAAATCGTCAAGCGTTGCTTGCAGTTTCTGCTGCCACA
CGCGAGCCACGATGTCTGGTCGATCTTGAGCTGTCTGGATATCGGAAGGTATCGCTTCAAGAATCTCGTCCCATTTGGGGTTGCACGTTTCAGTCAGGAA
GACGTCGGGCCGTCCATACTCTCGAACAATTGCCATCGAATCTTGATACGACTTGTACATGGACCGCGGGATACCCAGGTGCGAAGCCGGTAGTATGATA
CGCTTGCCAACCTGATTAAGAAAGTGGGGTGGTCGTCCTCTGCTGCCTCCGTCCCGGTCCGGGTGCACCAATCTGTTCTGGGCCTGGTCATATTCCGACA
GCAGCACTTCTCCTTCCGCCAGAGTCAAAGTATCCTCATTGAGCAAAGCGTCTTGAACACCCCTGTATTGATCGGCTCGAAGTGTTTTTTGATAGTCGGC
CACCCAGCGAAGCTGTTCTTGCTCACATTTTGCACGCTGATCTACACACCACTGTTGAAATAGACGCCCACCTTGGTGGAGAGCGGACTGATCATCCACT
TTCTGATGAAGGCGGAATGCGACGTGTTCACGAAGCGACATCGCCTTCTTGTTTCGATACTCAGCACCATTCGCGAACTCGTCTGTGTAGGTCCAGCCCT
TCTCTCCATATGGAAGGAGAAGCGGGTATTGAAGTGGATCGTAATCGGCGTGAGTCTCATACAAACGTAGCAGCCTTTGATCGCGTGTAAAGAGAAGTAG
ATCCCGAGGCTGAGCCAGGTTGCCATCCTCAATGAGAGTCGCAGCCACTTCAGACACAGTGGGGCGGTTATGCGTCCTTGGTCGCGAGGAGTTATCATGC
AGACGGAAGACCAAGTCTACTGGAGCCTCCATGTTGTGTTGACGCACTTGCTGCCCAAAGTGGAGGAACCGTTGCGCTAATGGGTTGTGCTCTGCCATCA
TTTTCTCGATGTCTAGTAGTGCAATACGATCCAAATCCGCGAATATACCAAGACGTCGCTCCGCGCGGTGTTGCATGTCTGGATCCACAATATAGATCTG
CGCAAACTTGGGTGCTACCCGCGCGCCTGTCCGACGGTCTATGTGGGGGAGGAGAGACCCTAGGTAGTGCCCCATAGCCCCTTGAATGCGATATGTGTAC
ACCCCGTGTGTACCGGCAACGCTCTCGTCTTGACGTACGTTTTGAAACGATCGGTTTGAGCACGAAGCACCAATCGATGTAACCGCGAAGGCTTGGTTGT
AAGCACGAATTTGACGGCGGAACTCGGGATCTCCGTACAGCTGAAGCAACTTCCGTGGCGCGGGGTGCAGTGGAGGCAGATTTACCCTGCCTGCGAGACA
GCATGATATCACAGACTCCCCAGGCCACTTCCAAGCATTGCAGATCGGACAAACGGTTGTAGCCGGAAGCTTGTGCCGGCCGCTCACCACGTCGTCACCC
GTTATCATGGGACGCATCGAAGTCTTCGAGGGATATAAGAGCATGTCCATGACGGACACATTGTCGTCTAGTGCGCATCCGCTCGAGCTCGTACTGGCGC
TCGTCTTGTGTCTGCTCAGCTCGTCGATCAGCATGCCGTTGTCGGTTCAGCTCGCGTTCAGCCACCATGCTCTGGTCCGACAGGTTTGCTCGCCAATGCG
CATGTTGTTGACGGTTAAGTTCGCGTGCATGTTCCTGTTGCTGTCCCGACATCTGTGCCCGTCGACTCGCATGTTGCAGGCGGTCTCGACCGCGTACGGC
TTCCCGGTCTGGCTCCCTTAGCTCCGCTCTGTGTGCTGTTTGCTGCTGTCGATTCTGCTCCCGCTGCTCGTGAAGCTCTTCTCCGCGTAACTGAGCTCTT
CGGGCACGTTTGCGCTCAGCGTCTTTCTTCCTCGCACGATCACGCTGAGATAGTGTCATATTAATGCGCTTGGTTCGAGCTCGCTGTGCGTCGCGTGTGC
GTTCGCGATCTGCCTGAGACAGTGTCCTATTAGCTTATTTGTCGCGAGCTCGCTGCGCAGCCGACGGGACATCTTCTCGATCCGCTGATCCAGATACGAC
AGGTACTGTAAATAAAGCCGTATCCTCAGTTTCAGCTTGGTACGCCGCCTCCATTTCAGCCGCAAACCGGCGCTGAAGTAGCACAGGATCGGACTCTTCT
GTCTTTTCCTCCCGCTCTTCAATACCGTTGGCTTGACCTTCCGTAAATTCCGTAATCGCCGTAGCTTCTTGATGCACACTGAGGGCCTTCAGCTCTTTGT
TCAAGTCGTATCGTTTCTTCCTGCGCTTGGTCTGACGTCGTTTTCGTGCATCCTTTTCCTCTCGCATGGGTGTCGCGTTAATGCGTTCGTTCTCGTGCAG
GGCCTCCTCCAGTTCCTCGCGCGTCCTCTTTCGCTTACTCCGTCCCATAGTTCTGCGAACACGAAAACGTGACGCGTTAGACAATGTCTAAGTACACCGC
ACGTACCAGTAGGTTTTCATCGAGTAGTGTGTTGGAATATGCGTACTACCCGGGATTGCTTGCTCCCATCAAGGTTATCTCCGATCACTTATCCCACAGT
CACGGGCCGTGAGGCCCGGAGCGGTTTTAGTTTGCAAATTGTGCAGTCGAATCTCCAGGGTTGGGCCCCCGGATAGTACTGTAGCTTGAGGTGCGATATC
CTTTTGCCAAAAAGGCGGCCGTTAATTGCAAAGGCTGGTTATTGATAGGCTATTACAGCCCCCATCCCATATGTCGGTTAAAAGAGGCCAGTTACGGTAC
CCCCTTCTGACCAACTGCACGCACGCAATGTGCGTGCCCATCAATAACCATTAACGACCGGCTCAACTGGTTCGCTGTCGGGTTTGCGGTCAATGGACCA
GGTGCTAAATGTGCCCTCGCGCAGAGTGGGCGGTGGGATAAAGCCCCAAGAGCCCAGAGGGCTCTGGAACTAAATCCCCATAGCACGGCTACCTACTTGC
AGGATAAAATCCCGCAAGTTATAAGCTTCCCCCTAAGCAGCCCCAGGAACCTCGGACTATCTGTGTATGTGTGTCTTGCTAGCTACTAACGCAAACTAAC
ATGCATACACGCAGCGTACCTTGAGTAACGTGGCGTTCCACGGCTTCCGTTTTGAAAATGGGGGCAAAATGAAATTTGAACGGTGCATTTAAGTACGATG
TGTAGACCAAATACAGTGTGTACACCACATATTGCAATTTTAGCGAATCGAGGCCGCCTTCGCTGCGCTCGGCAGCCAGTAGAACGCGCGTATTTGCGTT
ACATTTTAGAACCCTACCCTCGGACGGACTGACAGACGGACGGACAACACACTCCACTAGGGGGGTAAGATAATGGAATGGCCGGATTCGCATTCAGCGG
CCAAGAACTGACCATCTACGGTACGAACCCTCGGTGGCGGTCGGGATGAGTTCGCGGAAGGCTCCGCGACCCTTTGAAGGCGCGGTCACCGTCTGGGAAA
AGGTGCGAGCTGTTAAAGATACTCATGCGACGATGCAGACGACGCTTGGCGTGCAAGAAGATCCATAACGGATCATTGCTCACTTGATATTTGCAAACTG
GATTAGGACTTCCTTTTAGGAATAGACCCGAAAGGGTAAACATAAATACAGAACAGAATTTCCACTCAAGCACACAGTGCGACGTCCGGCTTCAAGGTAA
GCGTCTGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAACTCGAAGCTCTGTAGCGAGGGTTCGTCCGGCAAGGCCAAGAGACTGTGTGTTTTGG
CCGATTACTATCGGGAGGTTTTACGTGACGGCTTATTGTTGCCTATTTGCACGACTGGGATTGCTTGTATTGCATCCCTTTTATTCTCCTAACCGAGTGT
TGAACACTCGGTGCCCTCGTAAAAGGCTTACCCGTGCCTGGTACCCTTCCGCTGTTGGGACCACGAGGATTTATAACATCTGCTAGCTTTGATCGTGCTA
GTAGCGTGTTCTTTATTTTACTGGTTGGTCTATATAAGTATCCAGTCTGTCCCGGTGCAAGGCCAGAACTGGGGTCTTCAGGTCCTTCCGAACGATCGTT
TGCTATCCTAGCAGACGTATTGTTGTGGGAACTGTGGTGTAGTAGAACACACAAATACCGTCAGATGTGGATTCCTTACACAAACCACAACAAATCGCCG
AGTTAGGTCGGCGGTTGTATGGCCTGCGCAGAGGGTGGTCCCCTCGCGGTCCGGCCCTTCCGGGACAGACGAGTGGCTCGCTTCCACTCGGCTCCGACTA
ACCAAGTCAGATCACTTCCGAGGCTCCGCCGAGTTTGGTTCGGCTGAGCTCGTTCACAACCCTGTGCCCTCCACCTAAGGATGGACGACGGCGCGCGAGC
GCTTTTACAGGTCACCGAGCGCAGAGGCTGCTCGGCTAGAAGTGTTACGGCACCCGGGCTATCCGACGTACCGGCCCGCTGAGTTTGCGGGGCTTTCTTT
CGCGCGTAGCGAGACTTTGTCCTACCCGGACCGATCTAATCTCTTGACGCTACCAGTCAATACCCTACAAGCTATGCCTCTCGAGTATTAACGACAGGCA
TAATCCAGCCCTAGGCAGGGACTTACCGGAAGAGTGTACACTTGTCTTGGACTATGAAAATTCTGCTCTGTTATCTTCTGGGAGTCTTTTTGGCCCCCCC
CATTTAATCATATGCTTCTCATACAAATATCTAGTGAAACGTAGTCGTTTCGGATCTCTAACGA