Description :
Non Conding Region
Location :
Scaffold_1:95951- 96896
Sequence
945 bases(100 bases per row)
GCTGTTTTGCTGTGCTTGGTGTAGTTTTAAAAGGGTATCACAATCAATCAAATTTTTGATTATACATAATAGTGAAGAGCCTTCTCATTTGCTGTAGAGA
TGACGTTCTAAGATGTGCATGAGGGACTGAATTGCAACAAGATAGACTCCAAATTACAAGCAGATTCCTGAGCTGTGAGCGGATCTACTGATGACGCAGA
CTGCAAAGGATTCATATATAAATATCAAATTTCCTTCAGTGATTCATAATATGTCGATAGCCTCGGAAGCTTACTAAACAACCAAGAGGTCAGCGAGCAA
ATTTTGAGTTTCCTTGCGCCGTAAGTATCTGAATCCTTTCGATAAGCTGACCATTCATTGTAGCTTGGGAGAAATGCCTCGATCAACCACCTTTACGTCT
TTTAGGAAAAAGGTGCGATCACATCATGCGTGCGGAATACAACTGCGAGTCCCAGGTAGCACATTTGGTTCTGAACGTAATGCCTCAAGTCTACCGACAT
GCATTCAGCAATTGTGATCTCGGCTTTGGCGCAATCCCATAAACCTGACATTATATAACCAGATTTACCTGAAATCCGCTTTGTACATGTTTGCTTGCGT
GTACCTTCGTTCGATTCTATCCTATCTCATAAAGCCACGCTCAGCACCAATTCTTCAAATGATTGCCAGCTCAAACTTGGTGTTGACCACATACTTTGTG
GATTACAAAGATCGATTGCAACATGAGCGATTCTGCCAAAGCTATTAAGCCGAGCAATGAAGTATCCCTTGGCATGCTGCGGAAACGAAGATCTTCCACC
ATGCACAGCTCTGGCTCTCACCGCTCTTTTTTTTCAAAGCATTCCAATTCATTCTCAAGGTCCCATCAGCACAGAAATTCAGCACCATCAACTATAAAAA
AATCCTCCCTGTCAGCATGGAATAAATTTTGGCTTCGTATCTCCA