Description :
Non Conding Region
Location :
Scaffold_1:95755- 96313
Sequence
558 bases(100 bases per row)
ATTAACTGCTGTCAATGAAATTTCTGCTACTCAACTAGACTGCAGCTAAAATGTCCGTGCTATCATCGCGCTTAGCGATCCGTTGTTCATGTGCAATTGG
CTGCTCAGTTTCGTGCGGGTCTTCGGCGACGCTGGCTGGCGCAAAGCGCAAAAGGGGGTCTTCTCCACCATAGTGTCTTGAGTCAGGGTAAGTAAATTGT
GGAGAACTACGCAGCCTATAATTGACTTACACATTATCGGAGGACGTTTCCTCTAGCTTACCTAACACAATTCTGAAGCGTTTCTTGAGGCGGCCGAAAG
CACACTCGACACCAATTCTTGTTCGAGAGTGCGTCAGATTGTACATGTGCTTCCAGCGATCTTGTACTGCCTCGGCTTCCGGAATCGTCGTGAGCATGTG
GGTCCACAAATTGTAGCCCGCGTCTACAACTAAGTGTTTCCTGGTGGAACAAAGCTTGAGAGCCTAAGACGCACAAGTTCAATAGATTAGATAACAGCGT
AGCATAGATAACCAAACCGATAACTTACCGTTTCCGTACAGCAGACCCATTCCACAGC