Description :
Non Conding Region
Location :
Scaffold_1:95559- 95833
Sequence
274 bases(100 bases per row)
GACAGTTTTTGACAACGAGGACCGGACGGATAGGTTAAGAATGCGGAGATATCTCTACCAGCATCTGTATAGCAAACGAAGTTCTGGTGAAGCAAGCGAA
TGCTACGAATGTCGCTAGCCAAGTAGTTATGATAAGCTAGTGTGCTGTTTGTTCCTGTGGCCAACCTTACTTGTAGGTAGATCATTTGGATGAGATCTTG
AACCCACGATTTCAGTCTGAGGCTATTCGAAATCAGTTTGCAGCTTGAAATATTCACAGCTCGAAGAAGCACAA