Description :
Non Conding Region
Location :
Scaffold_1:95551- 96228
Sequence
677 bases(100 bases per row)
GCTTGTTTTTTTTGTGAAGAATGCGGTGCCTCGTGTGACAAGATCCCCACTTTAGTGACTATTGATCTCTAAATGATGATAGTCATTAAAGAGGGGGTAT
GTCACAAAGTTCAGCTGCTTCAACCGCCTCTATCTGAAGCAGAGTGCCACCGAAAATGATGATCGCTATGAGCAGCCGTAGTGATGAGCCGCCCGCCATG
TAGAAGCCCAGCTCCGCTCATCCACCTGTCTCTCCGTTCTCGACCATTCCTGACTCCCGCGTGCCACGTTAACTCTATCAACGTGGCTCACCGGCTGGCA
AGCAGTTGCATCTCTCTCGCTCCATCCAGTGCCACTAGTCGGAACAAGAGAAGCCCAGAAGAGAGCCATTCGCTCGCGCTTCTTCACCACAAATAAGAAC
CCGCGCGCGCGTCTACAGTAGAAAAACGATGTGGAGCACAAGCGCACGCTTCTGGTGAATCCAAGCCAAGCTGGCTGTCTCATTCCCGGATTCACCGAAC
GGCGGCTTCCGCAGAGGCAGTGTGCTCCCACTTACGCGCTCATTGTTGACCAAGCGTCGCAGCTCACAGGCGAGTCGATCGTAAGCGTGAACATGGGCGA
CGAGAAGAAGACCGGACTGCGTCGCGTCGGTGCTTGGTGCGTGCGGCTCATCGCGCGCGTGTCCAAGCACAGCGACA