Description :
Non Conding Region
Location :
Scaffold_1:95472- 96509
Sequence
1037 bases(100 bases per row)
TCTATTCGTTGTCGTTGTTTCTGGTCAGCAATCGCTATGCGCTTTTTCCAGGGAGATTTGAATGCTCGCTGCTTAGCACCCAATACAGTAACCGCTTGTT
tCTCTGGAGATGCTTTGCTTGCCATTTTACGATGACGAACCTGTCGTTTGGGAGTGTACCTATCACTCTTGAATCTCTGAAGTTGATCATACAAAGAAGC
TTTGTTGCTTGCAAGATCAGCTTGACGTTCCAGTTCACTGACCGCTCGCATGTCGTCAGGAGATAGAGCAGGcAACCGCGAAAGACCTTGTCGAGTACGA
GGTGAGAcGGTCGAAAGCAATGGGAGGACAGAAGGTAGTACTCCATTGATTtGTGGGATGACGGCGTCGTCAATCGAGGCTGTGGCAGGTGATATTGTTG
ATTCAGAGGACGCATACCGTTCGATAGTGTCCAgAACGGGGGgCTCAATATCACAAGCGtCGTTTTTCAGTGCATCGCGTAAAATCTCATCGACAAGTTG
TGGCTGGTCAAGGTACTGCTCAAGCGTTGGGACGTCCGGGGTCgTGTAGATTGATGGCAATCTGGTTGCCTCATCTTGGTCAACCATAGTGTCTTCCTCT
CGTGAGCTTGGTCGTACTCGGGCCACGGCGCTTCGATAGCTCAATCTGACCGCCATCTGACGGTTTTTtCGACTGCCTGATGCGTTCTTGCCATTGACTA
ATCGCCCATCGAGGgTGCCTCGTCGTTCCTGATCGCCTTGGAGCAGTGATGATGACTGTTCCAGCACTCGGCGccatttcttaggctggaaNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNg
tgtccagcgcttcttggtgctaagttcgcATTcTtCACAAaCCACAAGTTCAAAAaCCACATGACCATCATTCTGGTTCAAGTTCGCATTAAGTCCGTGT
CAGTGAGAGGTATCATGAAGCGACACACTGGAGACCA