Description :
Non Conding Region
Location :
Scaffold_1:95207- 97744
Sequence
2537 bases(100 bases per row)
TCCAGCACGAAGGACGTGGCGTGGACCTCGGACGCCGACCGCACTCGTGCAGCCACGCACACCCATGATGACGCCACTGCCGCCAGCAGCAGCGCGACAG
CGTTGCGAGCGACGCGACGGCCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCCTCCCGGATTGGCAAAATAAATCATTCTTAAATCG
AAAGATCTGTAAACCTGTTCTCCGATTTCAACCAAATTGTGTGTTTGACCAAGGAACATTTTGTGACCTGGTGGAACATTCTGTGGCTCCCCTCCCAAAA
GCGTTTAATGAAATTTTAGAGCTAGTTATTATTATATTTATATGGAATTTAGAAAAGGCGAACTTCAAGAATGACCAGTGGATGCGTTTCAGATTGCATG
AGGTTAGGGTTAAGTTTCGATACGTCCGCCGCACCGACCCAACAATTATGGTTGGGATCCACATCCCGTGGTTTTGTTGGGAGCCGAGAACCGTTATTTC
CAACGTTGGCGGATAGGCACGAGGATGCCAACCATGGCACTGAGCGCGCGCATGGCGACTCTGGTGGTGGCGCTGTTGCTTTGGGGGGCCGTCGCCGACG
AGACCAGTTCACACGCGGTGCCCTCGGCGCCAACAAATGGTGGCGAGCCCTCGGCACTGCTCGAGAACGACTTTCCCCGCAGCGCATTCCACGCCCCCAC
CGCCACGCCAACAAATCCAACAAATCCAACAGCGCCATTGTCTCTTTCGCCAGTCGCAGATCCCGTCGTGGATCTCGCATCCCACCGCCGCGAGCACGCG
CGGCTCAGCGCCCAGAAGACGGAGCTCACGACGCAGCTCCGCGAAGCGCGCTTGCAGCTCGAAGTGCTCGAGATGCGCATTTTCAACGAGCAGCGGTTTT
ACGAGGAAACGCACGCCTCGGTTGTCGTCCGAAATGCCATGCCCTCGCCTCGAGGCGCCGTGCTCCGGCCGCTCGAGTGCCAGGGCTGGAAAAAGACGGG
CCGCTGCACCCCGCGCGGCGAGCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGGACGAGATCCAGGGCGGC
GCCGCCGGCTACTGCGAAGTGCGCGACGCAGCGACCAACGAGTTCTTCAAGGTCATGCGCGTCGGCTGCGAGACGCTGCCCACGAGCGTGAGCTTCTGGT
GCGAGCTCGCGCCGCAGTTTGCCAACGTGCCGGCCGAGATTGAACGCGCCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGCTCGAGCGCACGATCCGCGTGCTG
CGGTCGCTGGGCTGCGCGCTGCCCATCGAGGTCTGGTACTTTGAGGTCGACATGGCCGCCCATGCGAAAGCCCACGGCTCGCGATGGGCGCCAACGGACC
CGCACACGGAGATGCGGCCGTTCACGACGCTGCCCTTCACGCTCACGGCGACCAAGTACGCGAGCATCCACGCGGTCGTCCACAGCAAGTTCTCGCAGCT
GCTCTACTTGGACAGCGCGACTGAGCCGCTGCGGGATCCAACGTACCTCTTTTCGCTGGCCGAGTTCCAGTCGACTGGCACCGTCTTCTGGCCCGACGTC
GTCCACGCACAGTCGCCGACGGCCCGCGTCGTGGCCAATTCGCTGCTGTGGGAGCTGCTCGATATGCCATTTGTCAGTATGTTTGAGCAGGACGATCGCC
AGGTGCTCATTAACCGGGAGGTCCCTCGGGTCCGCACGGCGCTGCGTGTGCTCAAGCTCTTCAGTGAGCAGCGGCCGAGCCTCTTCTACAAGTTCGAGCT
CGTCGACGGCACCAAGGACTTCGCACGGCTCGCGTGGCTCAAGACGCGCGCGGCGTTCCACATGGTCGCGGTGCCGCCGACGCTCGGCGGCGTGGCACTG
GCCGGCGACGGGCGGTTCTGCGGCACCCACGTCGTACAGCACGGTCCGAGCGGCGAGGAGCTGTTTGTGCACCGTCAGCGATCGCACGTGGAGGATGCCC
CGGACCAAGAAGGTGGAGAGACGGCGATCACGCACGCGCAGGTCTTTGATTGGCGGCCAACCGGGGAATCGGATCTCATGCGCGACTACGACGTGCGGTC
CTTTGAAGCGAGTGTCAGCGGCCGCCAAGTCACGTGCCTTGCCCACGAGTCGAGGCATGAAAAGGTCGCGACGAAACCGTGGCGCGAAAGACAGTGAGGG
ATGAGTAGTAGTAGACTAAGTTATTATTCTGCACCGTAACGCATGCGTGTCTCTGGACATTGGACGAGCGCACCCTGTCTGGGGCAAATGAGACCTTGAG
GGATGACCGGTGCTGCTGATACACTACACCGTGCGGGCGGTAGGAAGCCCCAGGACGGGAACCCCCACCTGGCCTTGTGAGTGGTTTGAGAACCGCTCTT
GTCCATTCCGAAAGTGGTGACCACAATCCCGTGTCAT