Description :
Non Conding Region
Location :
contig_1:95181- 95833
Sequence
652 bases(100 bases per row)
CGGAGGCCTGGAGGGAGGAGGGGGAGTGACGGACTGGTACTCGGACTCTGGCTTGACGACGATCGCAAGTCGGAGTTTCGAGACGACGCCACAAAACCAG
CCAGGCGTTGTTCCTACCTGCGACTTGGTACAGTGTACCGGTCCGTACCACGTCAAGGCGAGACTAGGGGATTCCTATACAATAAACAAGAGCGGAAAAT
TTTGTGCTTGATAGCGGCGACCTTGCTATCAAGTTGTAGTGGCAAGATGCATCTAGCGTAGGTAGGTGCTGGTTGATGGAGTCATTTACGGCCGATGGAT
TCTTCTTTGGGCGCGGTTACGCGGCTCAATAGGAGAGGCGCAGTGACGTGCGCACAGATACTTGACACTTGGCGCGGTTGGGATGGCTACGCTTTACCCC
AGCAGCGCCAACGCAATGCAGCTGCTTTCGTTACGGGTGGCAAGATCGCTCGTGACTCACTTGGATACGCGGAGCCGATTGTGTGCCTGTGGGGCAATGG
AGACCTTGCCTCGATGTCTTGCTTCCTCGAGCTGCAACCACCGATGCAAATCAGTCCTGCGTGTAGTCAGCGCCCGCGCAACGGCCAACAGCTCACTACT
TCCTGGTAGTCATGACTGGCTTGCCTAAAACTGTAGCCATCTCCGAATCCAA